Aftermath

At the time of the anthrax outbreak in Sverdlovsk, the Biological Weapons Convention was in place.  Did the Treaty fail?  Did the Soviets violate the treaty? 

For this conference, investigate the aftermath of the anthrax outbreak.  How did the world community respond?  Did the treaty have the effectiveness it required?  Would you have conducted the response differently?  How might a similar outbreak be investigated today? 

Demonstrate your research competence by finding information related to this topic

APA format, 2 pages, in-text citation, references include

The Sverdlovsk Anthrax Outbreak of 1979
Author(s): Matthew Meselson, Jeanne Guillemin, Martin Hugh-Jones, Alexander Langmuir,
Ilona Popova, Alexis Shelokov and Olga Yampolskaya
Source: Science, New Series, Vol. 266, No. 5188 (Nov. 18, 1994), pp. 1202-1208
Published by: American Association for the Advancement of Science
Stable URL: http://www.jstor.org/stable/2885382

.

Accessed: 16/09/2013 14:56

Your use of the JSTOR archive indicates your acceptance of the Terms & Conditions of Use, available at .
http://www.jstor.org/page/info/about/policies/terms.jsp

.
JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide range of
content in a trusted digital archive. We use information technology and tools to increase productivity and facilitate new forms
of scholarship. For more information about JSTOR, please contact support@jstor.org.

.

American Association for the Advancement of Science is collaborating with JSTOR to digitize, preserve and
extend access to Science.

http://www.jstor.org

This content downloaded from 129.2.19.102 on Mon, 16 Sep 2013 14:56:35 PM
All use subject to JSTOR Terms and Conditions

http://www.jstor.org/action/showPublisher?publisherCode=aaas

http://www.jstor.org/stable/2885382?origin=JSTOR-pdf

http://www.jstor.org/page/info/about/policies/terms.jsp

http://www.jstor.org/page/info/about/policies/terms.jsp

A 20~>
25 mK

3.0-

v1/2 1.

2.0

9.0 9.5

0.0
0.0 0.2
Magnetic field (T)

Fig. 4. The resistance R = V34/121 for the magnet-
ic focusing sample shown in the inset. (A) Focus-
ing peaks of electrons near B = 0, and (B) focus-
ing peaks of composite fermions near B* = 0 (that
is, near v = 1/2). The scales of B and B* differ by
a factor of about \/. A qualitative difference be-
tween the positive and negative B* (that is, be-
tween v > 1/2 and v < 1/2) is evident, as is the one-to-one correspondence between several composite fermion and electron focusing peaks. [Reprinted from (30) with permission of Goldman etal.]

the lattice; some of the most relevant com-
mensurate orbits are shown in the figure.
Similar dimensional resonances of compos-
ite fermions show up near B* = 0. Goldman
et al. (30) observed magnetic focusing of
composite fermions near v = 1/2. The ex-
perimental setup is shown in Fig. 4.; the
current flows from 1 to 2, and the voltage is
measured between 3 and 4. Near B = 0, a
number of quasi-periodic peaks are observe

d

(Fig. 4B), which occur at those values of B
where the electrons coming straight out of
the left constriction are focused into the
right constriction, possibly after several
specular reflections from the gate. Similar
quasi-periodic structure was observed near
B* = 0 (Fig. 4A). The close correspon-
dence between the electron and the com-
posite fermion peaks is evident in both Figs.
3 and 4. These experiments confirm the
existence of composite fermions in the
compressible region near v = 1/2 by dem-
onstrating that the dynamics of the charge
carriers are described by the effective field
B* rather than the external field B. Thus,
the composite fermion framework has not
only provided a simple “one-step” explana-
tion of the FQHE, it has also helped reveal
the nontrivial nature of the metallic state at
even-denominator fractions.

Conclusion

The following picture has finally emerged.
First, electrons form LLs because of quan-
tization of their kinetic energy. This re-
sults in the JQHE. Within the lowest LL,
in a range of filling factor, electrons min-
imize their interaction energy by capturing
vortices and transforming into composite

fermions. Even though the composite fer-
mions are quantum mechanical particles
with a true many-body character, they
may be treated, for most purposes, as or-
dinary noninteracting fermions moving in
an effective magnetic field. They form
quasi-LLs, execute cyclotron motion, and
fill a Fermi sea. The formation of compos-
ite fermions lies at the root of the FQHE
and several other fascinating experimental
phenomena.

REFERENCES AND NOTES

1. E. H. Hall, Am. J. Math 2, 287 (1879).
2. K. von Klitzing, G. Dorda, M. Pepper, Phys. Rev. Lett.

45, 494 (1980).
3. D. C. Tsui et al., ibid. 48, 1559 (1982).
4. See L. D. Landau and E. M. Lifshitz, Quantum Me-

chanics (Addison-Wesley, Reading, MA, 1965), pp.
424-426.

5. R. B. Laughlin, Phys. Rev. B 23, 5632 (1981).
6. , Phys. Rev. Lett. 50, 1395 (1983).
7. For example, G. Fano, F. Ortolani, E. Colombo, Phys.

Rev. B 34, 2670 (1986); F. D. M. Haldane and E. H.
Rezayi, Phys. Rev. Lett. 54, 237 (1985).

8. F. D. M. Haldane, Phys. Rev. Lett. 51, 605 (1983).
9. B. I. Halperin, ibid. 52, 1583 (1984).

10. See J. K. Jain, Adv. Phys. 41, 105 (1992).
11. S. M. Girvin and A. H. MacDonald, Phys. Rev. Lett.

58, 1252 (1987).
12. S. C. Zhang et al., ibid. 62, 82 (1989).
13. N. Read, ibid., p. 86.

14. J. K. Jain, ibid. 63, 199 (1989).
15. To see how multiplication by the Jastrow factor at-

taches 2m vortices to each electron, fix all z, in the
Jastrow factor except z1I As z1 traverses in a closed
loop around any other electron, it acquires a phase of
4m7r, that is, it sees 2m vortices on all other electrons.

16. N. Trivedi and J. K. Jain, Mod. Phys. Lett. B 5, 503
(1 991).

17. G. Dev and J. K. Jain, Phys. Rev. Lett. 69, 2843
(1992).

18. X. G. Wu, G. Dev, J. K. Jain, ibid. 71, 153 (1993); X.
G. Wu and J. K. Jain, preprint.

19. E. H. Rezayi and A. H. MacDonald, Phys. Rev. B 44,
8395 (1991); M. Kasner and W. Apel, ibid. 48,11435
(1993); E. H. Rezayi and N. Read, Phys. Rev. Lett.
72, 900 (1994).

20. V. J. Goldman etal., Phys. Rev. Lett. 65, 907 (1990).
21. J. K. Jain, S. A. Kivelson, N. Trivedi, ibid. 64, 1297

(1 990).
22. B. I. Halperin, P. A. Lee, N. Read, Phys. Rev. B 47,

7312 (1993).
23. R. R. Du et al., Phys. Rev. Lett. 70, 2944 (1993).
24. Also see, I. V. Kukushkin, R. J. Haug, K. von Klitzing,

K. Ploog, ibid. 72, 736 (1994).
25. D. R. Leadley et al., ibid., p. 1906.
26. R. R. Du, H. L. Stormer, D. C. Tsui, L. N. Pfeiffer, K.

W. West, Solid State Commun. 90, 71 (1994).
27. H. W. Jiang, H. L. Stormer, D. C. Tsui, L. N. Pfeiffer,

K. W. West, Phys. Rev. B 40, 12013 (1989); R. L.
Willett et al., Phys. Rev. Lett. 65, 112 (1990).

28. R. L. Willett, R. R. Ruel, K. W. West, L. N. Pfeiffer,
Phys. Rev. Lett. 71, 3846 (1993).

29. W. Kang et al., ibid., p. 3850.
30. V. J. Goldman et al., ibid. 72, 2065 (1994).
31. V. J. Goldman, unpublished figure.
32. Financial support from the National Science Founda-

tion under grant DMR93-18739 is acknowledged.

The Sverdlovsk Anthrax
Outbreak of 1979

Matthew Meselson,* Jeanne Guillemin, Martin Hugh-Jones,
Alexander Langmuir,t Ilona Popova, Alexis Shelokov,

Olga Yampolskaya

In April and May 1979, an unusual anthrax epidemic occurred in Sverdlovsk, Union of
Soviet Socialist Republics. Soviet officials attributed it to consumption of contaminated
meat. U.S. agencies attributed it to inhalation of spores accidentally released at a military
microbiology facility in the city. Epidemiological data show that most victims worked or
lived in a narrow zone extending from the military facility to the southern city limit. Farther
south, livestock died of anthrax along the zone’s extended axis. The zone paralleled the
northerly wind that prevailed shortly before the outbreak. It is concluded that the escape
of an aerosol of anthrax pathogen at the military facility caused the outbreak.

Anthrax is an acute disease that primarily
affects domesticated and wild herbivores
and is caused by the spore-forming bacteri-
um Bacillus anthracis. Human anthrax re-
sults from cutaneous infection or, more
rarely, from ingestion or inhalation of the
pathogen from contaminated animal prod-
ucts (1). Anthrax has also caused concern
as a possible agent of biological warfare (2).

Early in 1980, reports appeared in the
Western press of an anthrax epidemic in
Sverdlovsk, a city of 1.2 million people
1400 km east of Moscow (3, 4). Later that
year, articles in Soviet medical, veterinary,

and legal journals reported an anthrax out-
break among livestock south of the city in
the spring of 1979 and stated that people
developed gastrointestinal anthrax after
eating contaminated meat and cutaneous
anthrax after contact with diseased animals
(5-7). The epidemic has occasioned intense
international debate and speculation as to
whether it was natural or accidental and, if
accidental, whether it resulted from activi-
ties prohibited by the Biological Weapons
Convention of 1972 (8).

In 1986, one of the present authors
(M.M.) renewed previously unsuccessful re-

1202 SCIENCE * VOL. 266 * 18 NOVEMBER 1994

This content downloaded from 129.2.19.102 on Mon, 16 Sep 2013 14:56:35 PM
All use subject to JSTOR Terms and Conditions

http://www.jstor.org/page/info/about/policies/terms.jsp

*

ARTICLES

30 –

25

en 20;

15-

10-4
z

5-d

1 2 3 4 5 6
Time (weeks)

Fig. 1. Time course of the epidemic: onsets of
fatal cases by week. The first week begins on 4
April 1979, the date of the first onset we recorded.
Ughter shading represents cases for which the
onset date is unknown and is estimated by sub-
tracting 3 days from the date of death.

quests to Soviet officials to bring indepen-
dent scientists to Sverdlovsk to investigate.
This resulted in an invitation to come to
Moscow for discussions with four physicians
who had gone to Sverdlovsk to deal with the
outbreak (including another of the present
authors, O.Y., who was a clinician in the
intensive care unit set aside to treat the
victims). In 1988, two of these Soviet phy-
sicians visited the United States, where they
gave formal presentations and participated
in discussions with private and government
specialists. According to their account, con-
taminated animals and meat from an
epizootic south of the city starting in late
March 1979 caused 96 cases of human an-
thrax with onsets from 4 April to 18 May. Of
these cases, 79 were said to be gastrointesti-
nal and 17 cutaneous, with 64 deaths among
the former and none among the latter (9).

The impression left on those of the
present authors who took part in the U.S.
meetings (J.G., A.L., M.M., and A.S.) was
that a plausible case had been made but
that additional epidemiological and patho-
anatomical evidence was needed. Further
requests by M.M. for an invitation led to an
on-site study in Sverdlovsk, initiated there
in June 1992, and a return visit in August
1993.

Starting in 1990, several articles about
the epidemic appeared in the Russian press

M. Meselson is in the Department of Molecular and Cel-
lular Biology, Harvard University, Cambridge, MA 02138,
USA. J. Guillemin is in the Department of Sociology, Bos-
ton College, Chestnut Hill, MA 02167, USA. M. Hugh-
Jones is in the School of Veterinary Medicine, Louisiana
State University, Baton Rouge, LA 70803, USA. A. Lang-
muir is in the School of Hygiene and Public Health, Johns
Hopkins University, Baltimore, MD 21205, USA. I. Pop-
ova is in the Social and Political Sciences DMsion, Ural
State University, Ekaterinburg 620083, Russia. A. She-
lokov is in the Govemment Services Division, Salk Insti-
tute, San Antonio, TX 78228, USA. 0. Yampolskaya is in
the Botkin Hospital, Moscow 125101, Russia.

*To whom correspondence should be addressed.
tDeceased 22 November 1993.

Table 1. Case data. Case numbers for fatalities are as they appear on the administrative list. Case
numbers for survivors are arbitrary. Days of onset and death are counted from 1 April 1979. Abbrevia-
tions: 0, onset; D, death; R, residence; W, workplace; *, unidentified man; ?, not known; ma, mid-April;
s, survivor; c, cutaneous survivor; +, in high-risk zone; -, outside high-risk zone; a, had two residences,
one in Compound 32; p, pensioner; r, daytime military reservist at Compound 32; u, unemployed.
Patients 25, 29, 48, and 87 were home on vacation during the first week of April.

Case Age/sex O/D R/W Case Age/sex O/D R/W
no. no.

* ?/m ?/? ?/? 51 31/m 10/15 -/?
32 40/m 7/? -/? 40 37/m 12/15 +/+
67 26/m ?/? +/+ 36 68/f 7/16 a/p
68 32/f ?/? +/+ 35 52/m 13/16 +/+

8 60/f ?/8 +/+ 34 43/m 14/16 -/+
18 38/m 6/8 -M/ 38 69/f 14/16 +/p
16 40/m 7/9 +/+ 39 49/m 14/16 +/+
66 55/f ?/9 -/? 41 41 /f ?/1 7 +/p

1 44/m 6/9 +/+ 42 43/m 15/18 -/+
2 46/m 6/9 +/+ 43 39/m 15/19 +/u
5 66/m 7/9 -/+ 44 47/m 15/21 -M

49 51/m 8/9 +/+ 45 45/m ?/22 +/+
21 49/m ?7/10 -/? 46 39/m 20/23 -/+

4 54/f 5/10 +/+ 47 41/m 21/24 -/-
6 40/m 7/10 -M/ 52 42/m 21/24 -/-

20 39/m 7/10 -/- 53 47/m 22/24 -/-
17 67/f 8/10 +/+ 48 57/f 15/25 +/-
9 72/f 9/10 +/p 54 50/f 17/25 -/?
7 52/f ?/11 +/+ 55 31/m 23/25 +/+

19 64/f 7/1 1 -/ 57 31//m 27/28 -/r
22 27/m ?/1 1 +/+ 58 32/m 29/30 -/+
23 43/m ?/11 -/r 59 55/m 27/31

3 48/f 4/11 -/+ 60 33/m 25/33 -/r
10 27/m 9/11 +/- 61 42/m 34/40 -/+
65 72/m 9/11 +/p 62 29/m 39/40 +/+
15 48/f 6/12 +/+ 63 25/m 37/42 -/+
25 46/m 10/12 -/- 64 28/m 42/46 -/
12 38/m 11/12 -/+ 90 28/m ?/s
1 1 27/m 12/12 -/r 82 68/f 13/s +/+
26 67/m 9/13 +/p 80 49/m 14/c
13 24/f 10/13 +/+ 84 55/f ma/c
24 65/f 10/13 +/p 85 40/f ma/s +/+
28 47/m 11/13 +/+ 89 50/f 34/s
14 49/m 12/13 -/+ 86 28/m 37/s
27 64/m 10/14 +/+ 81 29/m 38/s +/+
31 42/m 11/14 -/r 83 45/m 41/s +/+
30 52/m 12/14 +/+ 87 41/m 42/s +/-
29 45/m 13/14 +/+ 88 37/m 45/s +/+
50 72/f 7/15 +/p

(10). These included interviews with Sver-
dlovsk physicians who questioned the food-
bome explanation of the epidemic and with
officials at the military microbiology facili-
ty. These officials said that in 1979 they
had been developing an improved vaccine
against anthrax but knew of no escape of
anthrax pathogen. Late in 1991, Russian
President Boris Yeltsin, who in 1979 was
the chief Communist Party official of the
Sverdlovsk region, directed his Counsellor
for Ecology and Health to determine the
origin of the epidemic (1 1). In May 1992,
Yeltsin was quoted as saying that “the KGB
admitted that our military developments
were the cause” (12). No further informa-
tion was provided. Subsequently, the chair-
man of the committee created by Yeltsin to
oversee biological and chemical disarma-
ment expressed doubt that the infection
originated at the military facility and stated
that his committee would conduct its own

investigation (13). The results of that in-
vestigation have not yet appeared.

Pathoanatomical evidence that the fatal
cases were inhalatory, recently published by
Russian pathologists who performed autop-
sies during the epidemic (14-16), is sum-
marized in an earlier report from the present
study (17). Here we report epidemiological
findings that confirm that the pathogen was
airborne, and we identify the location and
date of its escape into the atmosphere.

Sources of Information

Local medical officials told us that hospital
and public health records of the epidemic
had been confiscated by the KGB. We nev-
ertheless were able to assemble detailed in-
formation on many patients from a variety
of sources. (i) An administrative list giving
names, birth years, and residence addresses
of 68 people who died, compiled from KGB

SCIENCE * VOL. 266 * 18 NOVEMBER 1994 1203

This content downloaded from 129.2.19.102 on Mon, 16 Sep 2013 14:56:35 PM
All use subject to JSTOR Terms and Conditions

http://www.jstor.org/page/info/about/policies/terms.jsp

records and used by the Russian govern-
ment to compensate families of the de-
ceased (18). Comparison with other sources
of information, including those listed be-
low, indicates that the administrative list
may include most or all of those who died of
anthrax. (ii) Household interviews with rel-
atives and friends of 43 people on the ad-
ministrative list and with 9 survivors or
their relatives (or both). The interviews
(directed by J.G.) were designed to identify
the workplaces and other whereabouts of
patients before their illness. (iii) Grave

markers, giving names and dates of birth
and death, that we inspected in the ceme-
tery sector set aside for the anthrax victims.
These include 61 markers with names that
are also on the administrative list and 5
with illegible or missing name plates. (iv)
Pathologists’ notes regarding 42 autopsies
that resulted in a diagnosis of anthrax (14-
17). All but 1 of the 42, an unidentified
man, are on the administrative list. The
notes include name, age, and dates of onset,
admission, death, and autopsy. (v) Various
hospital lists, with names, residence ad-

dresses, and, in some cases, workplaces or
diagnoses (or both) of approximately 110
patients who were apparently screened for
anthrax, 48 of whom are indicated to have
died. Of the latter, 46 are on the adminis-
trative list. (vi) Full clinical case histories of
5 survivors hospitalized in May 1979.

Current street and regional maps were
purchased in Sverdlovsk, which is known
again by its prerevolutionary name of Eka-
terinburg. The city is the seat of an admin-
istrative region, or oblast, named Sverd-
lovskaya. The city itself is divided among a
number of districts, or rayon, the most
southerly being Chkalovskiy rayon. A satel-
lite photograph of the city taken 31 August
1988 was purchased from SPOT Image Cor-
poration (Reston, Virginia). Archived me-
teorological data from the city’s Koltsovo
airport were obtained from the National
Center for Atmospheric Research (Boulder,
Colorado).

Case Data

Table 1 presents information on 66 pa-
tients who died and 11 who survived. The
fatalities include the unidentified man
and all people named on the administra-
tive list, except for three patients for
whom recent reexamination of preserved
autopsy specimens does not support a di-
agnosis of anthrax (19). For survivors, di-
agnoses of anthrax are supported by clin-
ical case histories or hospital lists or both
and by household interviews.

Overall, 55 of the 77 tabulated patients
are men, whose mean age was 42. The mean

I

2 4

d

Fig. 2. Probable locations of patients when ex-
posed. The part of the city shown in the photo-
graph is enclosed bya rectangle in the inset. Case
numbers, in red, correspond to those in Table 1

4 w D Y al and indicate probable daytime locations of pa-
tients during the period 2 to 6Apr1l 1979. Of the 66
patients mapped as explained in the text, 62

* _ mapped in the area shown. This distribution may
[5jn 3 be somewhat biased against residence locations,

62 3121420 13 j __because daytime workers not on vacation who
3442 both resided and worked in the high-risk zone are

mapped at their workplaces. Proceeding from
north to south, Compound 19, Compound 32,
and the ceramics factory are outlined in yellow.
The five patients residing in Compound 32 are
mapped at their apartments. Within the com-
pound, the placement of an additional, part-time
resident and of the five reservists is arbitrary, as is
that of the five residents and a nonresident em-
ployee in Compound 19. Patients known to have
worked in the ceramics pipe shop are mapped in
the eastem part of thefactoryarea, where the pipe
shop is located. Calculated contours of constant
dosage are shown in black. Approximately 7000
people lived in the area bounded by the outermost
contour of constant dosage, Compound 32, and
the ceramics factory. The terrain slopes gently
downward by about 40 m from Compound 19 to
the ceramics factory.

1204 SCIENCE * VOL. 266 * 18 NOVEMBER 1994

This content downloaded from 129.2.19.102 on Mon, 16 Sep 2013 14:56:35 PM
All use subject to JSTOR Terms and Conditions

http://www.jstor.org/page/info/about/policies/terms.jsp

I ARTICLES

age for women was 55. No man was younger
than 24, and only two women, aged 24 and
32, were under 40. Recorded onsets span a
period of nearly 6 weeks, 4 April to 15 May,
with a mean time between onset and death
of 3 days (Table 1 and Fig. 1).

Approximately 60% of the 33 men for
whom we have relevant information were
described as moderate or heavy smokers and
nearly half as moderate or heavy drinkers.
None of the women was said to have
smoked or to have consumed alcohol more
than occasionally. Few patients were report-
ed to have had serious preexisting medical
conditions. Among the 35 men whose oc-
cupation in 1979 we could determine, the
most common occupation was welder, ac-
counting for 7.

In descending order of frequency, symp-
toms reported in household interviews in-
cluded fever, dyspnea, cough, headache,
vomiting, chills, weakness, abdominal pain,
and chest pain. Two of the survivors inter-
viewed reported having had cutaneous an-
thrax, one on the back of the neck, the
other on the shoulder. Hospitalized pa-
tients were treated with penicillin, ceph-
alosporin, chloramphenicol, anti-anthrax
globulin, corticosteroids, osmoregulatory
solutions, and artificial respiration. The
average hospital stay was 1 to 2 days for
fatal cases and approximately 3 weeks for
survivors. To the best of our knowledge,
no human anthrax has occurred in the
Sverdlovsk region since 1979.

Public Health Response

Public health measures were initially direct-
ed by an emergency commission formed in
Chkalovskiy rayon, where most patients
lived and worked. On or about 10 April,
overall direction was assumed by a commis-
sion that was constituted at oblast level and
included the USSR Deputy Minister of
Health. Military personnel participated lit-
tle if at all in the implementation of med-
ical and public health measures.

Before the bacteriological confirmation
of anthrax, on 11 April (14), patients were
taken to hospitals served by the ambulance
or polyclinic of first contact. Starting on 12
April, most patients presenting with high
fever or other indications of possible an-
thrax or who died at home or elsewhere of
suspected anthrax were taken to city hospi-
tal No. 40, where separate areas were des-
ignated for screening suspect cases and for
treating nonsystemic cutaneous cases, for
intensive care, and for autopsy. Bodies of
those who died were placed in coffins with
chlorinated lime and buried in a single sec-
tor of a city cemetery. Medical and sanita-
tion teams recruited from local hospitals
and factories visited homes of suspected and
confirmed cases throughout the city, where
they conducted medical interviews, dis-
pensed prophylactic tetracycline to pa-
tients’ households, disinfected kitchens and
sick rooms, and took meat and environmen-
tal samples for bacteriological testing. Hu-

man anthrax is not considered contagious,
nor was there any evidence of person-to-
person transmission. In the part of Chka-
lovskiy rayon where most patients resided,
building exteriors and trees were washed
by local fire brigades, stray dogs were shot
by police, and several previously unpaved
streets were asphalted. Newspaper articles
and posters wamed of the risk of anthrax
from consumption of uninspected meat and
contact with sick animals. Uninspected
meat in vehicles entering the city from the
south was confiscated and bumed at high-
way checkpoints.

Starting in mid-April, a voluntary im-
munization program using a live nonencap-
sulated spore vaccine (designated STI) was
carried out for healthy persons 18 to 55
years old served by clinics in Chkalovskiy
rayon. Posters urged citizens to obtain “pro-
phylactic immunization against anthrax” at
designated times and places. Of the 59,000
people considered eligible, about 80% were
vaccinated at least once.

Geographical Distribution of
Human Cases

Most of the 77 tabulated patients lived and
worked in the southern area of the city
shown in Fig. 2. Of the 66 patients for
whom we have both residence and work-
place locations, 9 lived and regularly
worked outside of this area. Interviews with
relatives and friends revealed that five of
these nine had attended military reserve
classes during the first week of April 1979 at
Compound 32, an army base in the affected
area. Respondents stated and, in one case,
showed diary notes establishing that the
first day of attendance was Monday, 2
April, that classes began at 0830, and that
participants retumed home each evening.
Assuming that the reservists were exposed
while at or near Compound 32, this must
have occurred during the daytime in the
week of 2 April.

In order to locate the high-risk area
more precisely, we prepared a map showing
probable daytime locations of the 66 pa-
tients during the week of 2 April. Those
with residence or work addresses in military
compounds or attending reserve classes
were placed in the appropriate military
compound; night workers, pensioners, un-
employed people, and vacationers were
placed at their homes; and all other workers
were placed at their workplaces. This
mapped 57 patients in a narrow zone ap-
proximately 4 km long, extending from the
military microbiology facility to the south-
ern city limit. The remaining nine worked
outside this zone, but three of them resided
within it. Placing the latter at their resi-
dences gives the distribution shown in Fig.
2, with 60 of the 66 mapped cases in the

Fig. 3. Villages with animal 60030′ 61?000′
anthrax. Six villages where *-.
livestock died of anthrax in
April 1979 are A, Rudniy; B,
Bolshoye Sedelnikovo; C, ~
Maloye Sedelnikovo; D, Per-
vomaiskiy; E, Kashino; and F, . .
Abramovo. Settled areas are-
shown in gray, roads in white,
lakes in blue, and calculated
contours of constant dosage
in black.A

560401 B

D *……

56020 10

SCIENCE * VOL. 266 * 18 NOVEMBER 1994 1205

This content downloaded from 129.2.19.102 on Mon, 16 Sep 2013 14:56:35 PM
All use subject to JSTOR Terms and Conditions

http://www.jstor.org/page/info/about/policies/terms.jsp

high-risk zone, 2 cases east of it, and 4 cases
north or east of the area of the figure. Of
these six patients who both worked and
lived outside the high-risk zone, three had
occupations (truck driver, pipe layer, and
telephone worker) that might have taken
them there, one was temporarily working in
Chkalovskiy rayon, one was on vacation,
and inadequate information was available
for another.

At the northern end of the high-risk
zone is the military microbiology facility,
Compound 19, followed to the south by
Compound 32. Both compounds include
numerous buildings, with four- and five-
story apartment houses for about 5000 peo-
ple at the former and 10,000 at the latter.
The administrative list includes five people
who lived in Compound 19 and five who
lived in Compound 32. All of the latter
resided in four adjacent apartment buildings
in the eastern part of the compound. Inter-
views in Compound 32 indicated that all of
its residents who died of anthrax are on the
administrative list. Interviews were not
conducted in Compound 19.

Adjacent to Compound 32 and extend-
ing south-southeast for about 1.5 km is a
residential neighborhood with a 1979 pop-
ulation density of approximately 10,000 per
square kilometer, composed of small single-
story private houses and a few apartment
houses, shops, and schools. Just south of this
is a ceramics factory that had about 1500
daytime employees. Of the 18 tabulated
patients who were employees there, 10
worked in a large unpartitioned building
where ceramic pipe was made and which
had a daytime work force of about 450. The
attack rate at the ceramics factory therefore
appears to be 1 to 2%. Still farther south are
several smaller factories, apartment build-
ings, private houses, schools, and shops,
beyond which begins open countryside with
patches of woodland.

Animal Anthrax

Anthrax has been enzootic in Sverd-
lovskaya oblast since before the 1917 revo-
lution (20). Local officials recalled an out-
break of anthrax among sheep and cattle

south of the city in early spring 1979. A
detailed report of a commission of veteri-
narians and local officials describes the
epizootic in Abramovo, a village of approx-
imately 100 houses 50 km south-southeast
of Compound 19. The report, dated 25
April 1979, records the deaths or forced
slaughter of seven sheep and a cow with
anthrax that was confirmed by veterinary
examination. The first such losses were of
two sheep on 5 April, followed by two more
on each of the next 2 days, another on 8
April, and a cow on 10 April, all belonging
to different private owners. These losses
were substantiated by interviews we con-
ducted with owners of six of the sheep that
died. Respondents said there had been no
human anthrax in the village. During a
livestock immunization program started on
10 April, 298 sheep were given anti-an-
thrax serum or vaccine or both. The attack
rate among sheep at Abramovo therefore
appears to have been approximately 2%.

In addition, we obtained veterinary re-
ports of bacteriological tests positive for
anthrax in samples from three sheep from
three farms in the village of Kashino, one
sheep from Pervomaisky, and a cow from
Rudniy, the earliest samples being received
for testing on 6 April. Although other doc-
uments cite the forced slaughter of a sheep
in Rudniy on 28 March and the death of
another in Abramovo on 3 April, the ear-
liest livestock losses for which we have
documentation of a diagnosis of anthrax are
those in Abramovo on 5 April.

Altogether, Soviet publications (6, 7)
and the documents we obtained cite out-
breaks of anthrax among livestock in six
villages: Rudniy, Bolshoye Sedelnikovo,
Maloye Sedelnikovo, Pervomaiskiy, Kash-
ino, and Abramovo. All six villages lie
along the extended axis of the high-risk
zone of human anthrax (Fig. 3). The cen-
terline of human and livestock cases has a
compass bearing of 3300 ? 100.

Meteorology

Surface (10 m) observations reported at
3-hour intervals from Koltsovo airport, 10
km east of the ceramics factory, were exam-

ined in order to identify times when the
wind direction was parallel to the center-
line of human and animal cases. During the
time that the reservists who contracted an-
thrax were at Compound 32, but before the
first recorded human onsets, this occurred
only on Monday, 2 April, when northerly
winds from the sector 3200 to 3500 were
reported throughout the period 0400 to
1900 local time (Fig. 4).

During the rest of April, winds from this
sector seldom occurred, accounting for few-
er than 2% of reports. During the period of
northerly wind on 2 April, which followed
the passage of a cold front, the wind speed
was 4 to 6 m s-1, the temperature -10? to
-30C, the relative humidity 50 to 66%, the
sky cloudless, and the midday sun 390 above
the horizon. These conditions of insolation
and wind speed indicate that the atmo-
sphere near the surface was of neutral sta-
bility (21). As is consistent with this, tem-
perature measurements at 500 to 1000 m
indicated a slightly stable atmosphere at
0400 and 1000 hours, becoming neutral by
1600.

Discussion

We have presented evidence that (i) most
people who contracted anthrax worked,
lived, or attended daytime military reserve
classes during the first week of April 1979
in a narrow zone, with its northern end in a
military microbiology facility in the city
and its other end near the city limit 4 km to
the south; (ii) livestock died of anthrax in
villages located along the extended axis of
this same zone, out to a distance of 50 km;
(iii) a northerly wind parallel to the high-
risk zone prevailed during most of the day
on Monday, 2 April, the first day that the
military reservists who contracted anthrax
were within the zone; and (iv) the first
cases of human and animal anthrax ap-
peared 2 to 3 days thereafter.

We conclude that the outbreak resulted
from the windborne spread of an aerosol of
anthrax pathogen, that the source was at
the military microbiology facility, and that
the escape of pathogen occurred during the
day on Monday, 2 April. The epidemic is
the largest documented outbreak of human
inhalation anthrax.

The narrowness of the zone of human
and animal anthrax and the infrequency of
northerly winds parallel to the zone after 2
April suggest that most or all infections
resulted from the escape of anthrax patho-
gen on that day. Owing to the inefficiency
of aerosol deposition and resuspension (22,
23), few if any inhalatory infections are
likely to have resulted from secondary aero-
sols on subsequent days. A single date of
inhalatory infection is also consistent with
the steady decline of onsets of fatal cases in

Fig. 4. Wind directions 2 April 3 April 4 April
and speeds reported
from Koltsovo airport for 3600
the period 2 to 4 April
1979. Numbers at the /I/\ /19 \ 19
downwind end of each 2700 1 13,
line are local standard 0 16,
times. Inner and outer 22 1 22
concentric circles desig- 114,13 13
nate wind speeds of 2.5 16 10
and 5.0 m s-1, respec- 19
tively. Zero wind speed
was reported for 0400 on 3 April and for 0100 and 0400 on 4 April. No data were reported for 0700.

1206 SCIENCE * VOL. 266 * 18 NOVEMBER 1994

This content downloaded from 129.2.19.102 on Mon, 16 Sep 2013 14:56:35 PM
All use subject to JSTOR Terms and Conditions

http://www.jstor.org/page/info/about/policies/terms.jsp

ARTICLES

successive weeks of the epidemic.
Accepting 2 April as the only date of

inhalatory exposure, the longest incubation
period for fatal cases was 43 days and the
modal incubation period was 9 to 10 days.
This is longer than the incubation period of
2 to 6 days that has been estimated from
very limited data for humans (24). Experi-
ments with nonhuman primates have
shown, however, that anthrax spores can
remain viable in the lungs for many weeks
and that the average incubation period de-
pends inversely on dose, with individual
incubation periods ranging between 2 and
approximately 90 days (25, 26).

The absence of inhalation anthrax pa-
tients younger than 24 remains unex-
plained. Although nothing suggests a lack
of children or young adults in Chkalovskiy
rayon in 1979, they may have been under-
represented in the aerosol plume. Alterna-
tively, older people may have been more
susceptible, which may also explain the lack
of young people in epidemics of inhalation
anthrax early in this century in Russian
rural communities (27).

It may be asked if the geographical dis-
tribution of cases is consistent with the dis-
tribution expected for an aerosol of anthrax
spores released at Compound 19 under the
daytime atmospheric conditions of 2 April
1979. Contours of constant dosage were cal-
culated from a Gaussian plume model of
atmospheric dispersion, with standard devi-
ations given by Briggs for neutral atmospher-
ic stability in open country (21), a wind
speed of 5 m s-1, a nominal release height of
10 m, and no limit to vertical mixing (Figs.
2 and 3). The aerosol is assumed to consist
of particles of diameter <5 pLm, as can be produced, for example, by a laboratory aero- sol generator (28), and to have a negligible infectivity decay rate (<0.001 min-1) (2) and a deposition velocity <0.5 cm s-1, which is insufficient to cause appreciable reduction of dosage at downwind distances less than 50 km (29-31). Dosage contours are not shown closer than 300 m to the putative source, as the dosage at shorter distances depends sensitively on the effec- tive release height of the aerosol and the configuration of nearby buildings.

People indoors will be exposed to the
same total dosage as those outside if filtra-
tion, deposition, and infectivity decay of
the aerosol are negligible. The negligibility
of these factors is supported by the absence
of significant dosage reduction in field stud-
ies of protection afforded by tightly con-
structed buildings against an outside spore
aerosol (32).

The calculated contours of constant dos-
age, like the zone of high human and ani-
mal risk, are long and narrow. Contours are
shown at 10, 5, and 1 x 10-8 Q spore
minutes per cubic meter (Fig. 2) and at 0.5,

0.2, and 0.1 x 10-8 Q spore minutes per
cubic meter (Fig. 3), where Q is the number
of spores released as aerosol at the source.
The number of spores inhaled is the dosage
multiplied by the breathing rate. On the
innermost contour of Fig. 2, for example, a
person breathing 0.03 m3 min-1, as for a
man engaged in light work (33), would
inhale 3 x 10-9 Q spores.

The calculated dosage at Abramovo is
more than an order of magnitude lower
than that at the ceramics factory. This sug-
gests that sheep, reported to be more sus-
ceptible to inhalation anthrax than are
monkeys (34), are also more susceptible
than humans.

It has been suggested that if Compound
19 was the source, there would have been
many more cases in its close vicinity than
farther downwind (13). This expectation
may be misleading, for as a cloud moves
downwind it also widens. The total cross-
wind-integrated dosage will therefore de-
crease more slowly with distance than does
the dosage along the centerline. In the
present case, whereas the calculated center-
line dosage decreases by a factor of 40 be-
tween 0.3 and 3 km downwind, the cross-
wind-integrated dosage decreases by a factor
of only 4. Depending on the dose-response
relation, the crosswind-integrated attack
rate may decrease even more slowly than
this. Considering, in addition, the lack of
information regarding the exact locations of
people in Compounds 19 and 32 at the time
of exposure, the distribution of cases is not
inconsistent with a source at Compound 19.

More detailed comparison of the geo-
graphical distribution of cases with the cal-
culated distribution of dosage would require
knowledge of the precise locations of indi-
viduals in relation to the plume, the num-
ber of spores released as aerosol, and the
relation between dosage and response for
the particular spore preparation, aerosol,
and population at risk.

By far the largest reported study of the
dose-response relation for inhalation an-
thrax in primates used 1236 cynomolgus
monkeys exposed to an aerosol of the Vol-
lum 1B strain of B. anthracis (26, 35). This
provided data that, when fitted to a log-
normal distribution of susceptibility to in-
fection, gave a median lethal dose (LD50) of
4100 spores and a slope of 0.7 probits per
log dose (26, 36). This LD50 may be com-
pared with an LD50 of 2500 spores obtained
in an experiment done under identical con-
ditions with 200 rhesus monkeys (35) and
with a U.S. Defense Department estimate
that the LD50 for humans is between 8000
and 10,000 spores (8). For a log-normal
distribution with LD50 = 8000 and slope =
0.7, the dose causing 2% fatalities, as re-
corded at the ceramics pipe shop, approxi-
mately 2.8 km downwind of the source, is

nine spores. According to the Gaussian
plume model we have used, this dose would
be inhaled by individuals breathing 0.03 m3
min-1 at the pipe shop if the aerosol re-
leased at the source contained 4 x 1 O0
spores. In contrast, a release 150 times larg-
er is estimated if the calculation is based on
an LD50 of 4.5 x 104 spores, which has
been obtained for rhesus monkeys by other
investigators (37), and if it is assumed that
spores act independently in pathogenesis
and that all individuals are equally suscep-
tible (38). This estimate would be lowered
if allowance were made for nonuniform sus-
ceptibility. If these divergent estimates
bracket the actual value, the weight (39) of
spores released as aerosol could have been
as little as a few milligrams or as much as
nearly a gram.

In sum, the narrow zone of human and
animal anthrax cases extending downwind
from Compound 19 shows that the out-
break resulted from an aerosol that originat-
ed there. It remains to be learned what
activities were being conducted at the com-
pound and what caused the release of the
pathogen.

REFERENCES AND NOTES

1. P. S. Brachman, in Bacterial Infections of Humans:
Epidemiology and Control, A. S. Evans and P. S.
Brachman, Eds. (Plenum, New York, ed. 2, 1991),
pp. 75-86.

2. Health Aspects of Chemical and Biological Weapons
(World Health Organization, Geneva, Switzerland,
1970).

3. Posev (Frankfurt) 1, 7 (1980).
4. B. Gwertzman, New York Times, 19 March 1980, p.

1.
5. I. S. Bezdenezhnykh and V. N. Nikiforov, Zh. Mikro-

biol. Epidemiol. Immunobiol. 1980 (no. 5), 1 11
(1980).

6. Veterinariya 1980 (no. 10), 3 (1980).
7. Chelovek i Zakon 117 (no. 9), 70 (1980).
8. Defense Intelligence Agency, “Soviet biological war-

fare threat,” DST-1610F-057-86 (U.S. Department
of Defense, Washington, DC, 1986); L. H. Gelb, New
York Times Magazine, 29 November 1981, p. 31; J.
P. P. Robinson, Arms Control 3, 41 (1982).

9. R. J. Smith and P. J. Hilts, Washington Post, 13 April
1988, p. 1; M. Meselson, Fed. Am. Sci. Public Inter-
est Rep. 41, 1 (September 1988); I. S. Bezdenezh-
nykh, P. N. Burgasov, V. N. Nikiforov, unpublished
manuscript, “An Epidemiological Analysis of an Out-
break of Anthrax in Sverdlovsk” (U.S. Department of
State Language Service, translation 126894, Sep-
tember 1988).

10. N. Zhenova, Literatumaya Gazeta (Moscow), 22 Au-
gust 1990, p. 12; ibid., 2 October 1991, p. 6; S.
Parfenov, Rodina (Moscow), May 1990, p. 21; Pash-
kov, Isvestiya (Moscow), 1 1 November 1991, p. 8; V.
Chelikov, Komsomolskaya Pravda (Moscow), 20
November 1991, p. 4.

11. N. Zhenova, Literatumaya Gazeta (Moscow), 13 No-
vember 1991, p. 2.

12. D. Muratov, Yu. Sorokin, V. Fronin, Komsomolskaya
Pravda (Moscow), 27 May 1992, p. 2.

13. L. Chernenko, Rossiyskiye Vesti (Moscow), 22 Sep-
tember 1992, p. 2.

14. A. A. Abramova and L. M. Grinberg, Arkh. Patol. 55
(no. 1), 12 (1993).

15. , ibid., p. 18.
16. L. M. Grinberg and A. A. Abramova, ibid., p. 23.
17. F. A. Abramova, L. M. Grinberg, 0. V. Yampolskaya,

D. H. Walker, Proc. Natl. Acad. Sci. U.S.A. 90, 2291
(1993).

SCIENCE * VOL. 266 * 18 NOVEMBER 1994 1207

This content downloaded from 129.2.19.102 on Mon, 16 Sep 2013 14:56:35 PM
All use subject to JSTOR Terms and Conditions

http://www.jstor.org/page/info/about/policies/terms.jsp

18. Russian Federation, statute 2667-1 (4 April 1992).
19. L. Grinberg, personal communication.
20. V. M. Popugaylo, R. P. Sukhanova, M. I. Kukhto, in

Current Problems of Anthrax Prophylaxis in the
USSR (Moscow, 1974), p. 50.

21. S. R. Hanna, G. A. Briggs, R. P. Hosker, Handbook
on Atmospheric Diffusion (U.S. Department of Ener-
gy Report No. DOE/TIC-1 1223, Washington, DC,
1982).

22. D. E. Davids and A. R. Lejeune, Secondary Aerosol
Hazard in the Field (Defence Research Establish-
ment Suffield Report No. 321, Ralston, Alberta, Can-
ada, 1981).

23. A. Birenzvige, Inhalation Hazard from Reaerosolized
Biological Agents: A Review (U.S. Army Chemical
Research, Development and Engineering Center Re-
port No. TR-413, Aberdeen, MD, 1992).

24. P. S. Brachman, S. A. Plotkin, F. H. Bumford, M. M.
Atchison, Am. J. Hyg. 72, 6 (1960).

25. D. W. Henderson, S. Peacock, F. C. Belton, J. Hyg.
54, 28 (1956); C. A. Gleiser, C. C. Berdjis, H. A.
Hartman, W. S. Gochenour, Br. J. Exp. Pathol. 44,
416 (1963).

26. H. N. Glassman, Bacteriol. Rev. 30, 657 (1966).
27. A. V. El’kina, Zh. Mikrobiol. Epidemiol. Immunobiol.

1971 (no. 9), 112 (1971).

28. J. V. Jemski and G. B. Phillips, in Methods of Animal
Experimentation, W. I. Gay, Ed. (Academic Press,
New York, 1965), pp. 273-341.

29. A. C. Chamberlain, Proc. R. Soc. London A 296, 45
(1967).

30. T. W. Horst, in Atmospheric Sulfur Deposition, D. S.
Shriner, C. R. Richmond, S. E. Lindberg, Eds. (Ann
Arbor Science, Ann Arbor, Ml, 1980), pp. 275-283.

31. A. Bovallius and P. Anas, in Proceedings of the 1st
Intemational Conference on Aerobiology, Interna-
tional Association for Aerobiology, Munich, West
Germany, 13 to 15 August 1978, A. W. Frankland, E.
Stix, H. Ziegler, Eds. (Erich Schmidt, Berlin, 1980),
pp. 227-231.

32. G. A. Cristy and C. V. Chester, Emergency Protec-
tion Against Aerosols (Report No. ORNL-5519, Oak
Ridge National Laboratory, Oak Ridge, TN, July
1981).

33. D. S. Ditmer and R. M. Grebe, Eds., Handbook of
Respiration (Saunders, Philadelphia, 1958).

34. G. A. Young, M. R. Zelle, R. E. Lincoln, J. Infect. Dis.
79, 233 (1946).

35. J. V. Jemski, personal communication.
36. C. I. Bliss, Ann. Appl. Biol. 22,134 (1935).
37. H. A. Druett, D. W. Henderson, L. Packman, S. J.

Peacock, J. Hyg. 51, 359 (1953).

38. H. A. Druett, Nature 170, 288 (1952).
39. R. Scherrer and V. E. Shull, Can. J. Microbiol. 33,

304 (1987).
40. We thank A. V. Yablokov, Counsellor to the Presi-

dent of Russia for Ecology and Health, for letters of
introduction; Ural State University and its then rec-
tor, P. E. Suetin, for inviting us to Ekaterinburg; S.
F. Borisov, V. A. Shchepetkin, and A. P. Tiutiunnik
for assistance and advice; members of the Ekater-
inburg medical community and the Sverdlovskaya
Oblast Sanitary Epidemiological Service for discus-
sions, notes, and documents; interview respon-
dents for their cooperation; P. N. Burgasov, USSR
Deputy Minister of Health at the time of the out-
break, for documents regarding livestock deaths;
and People’s Deputy L. P. Mishustina for the ad-
ministrative list of those who died. I. V. Belaeva
assisted with interviews. We also thank B. Ring, W.
H. Bossert, P. J. M. Cannone, M. T. Collins, S. R.
Hanna, J. V. Jemski, D. Joseph, H. F. Judson, M.
M. Kaplan, J. Medema, C. R. Replogle, R. Stafford,
J. H. Steele, and E. D. Sverdlov. Supported by
grants to M.M. from the John D. and Catherine T.
MacArthur Foundation and the Carnegie Corpora-
tion of New York. This article is dedicated to Alex-
ander Langmuir.

Analysis and Expression of a
Cloned Pre-T Cell Receptor Gene

Claude Saint-Ruf,* Katharina Ungewiss,* Marcus Groettrup,
Ludovica Bruno, Hans Joerg Fehling, Harald von Boehmer

The T cell antigen receptor (TCR) 3 chain regulates early T cell development in the
absence of the TCR:x chain. The developmentally controlled gene described here
encodes the pre-TCR:x (pT:x) chain, which covalently associates with TCRf and with
the CD3 proteins forms a pre-TCR complex that transduces signals in immature
thymocytes. Unlike the X5 pre-B cell receptor protein, the pT:x chain is a type I
transmembrane protein whose cytoplasmic tail contains two potential phosphorylation
sites and a Src homology 3 (SH3)-domain binding sequence. Pre-TCR:x transfection
experiments indicated that surface expression of the pre-TCR is controlled by addi-
tional developmentally regulated proteins. Identification of the pT:x gene represents an
essential step in the structure-function analysis of the pre-TCR complex.

T cell development takes place in discrete
steps during which the TCR genes are rear-
ranged and expressed in temporal order.
During development of TCRo43-expressing
cells the TCRI gene is rearranged and ex-
pressed before the TCRot gene (1, 2). With-
out TCR rearrangement the development of
T cells is arrested at an early stage (3-5). By
introducing TCRI transgenes into mice
that are defective for rearrangement of an-
tigen receptor genes, it was shown that
TCRI proteins, in the absence of TCRt

C. Saint-Ruf is at the Unit6 INSERM 373, Institut
Necker, 75730 Paris, Cedex 15, France. K. Ungewiss,
M. Groettrup, L. Bruno, H. J. Fehling, and H. von Boe-
hmer are at the Basel Institute for Immunology, CH-
4005 Basel, Switzerland.

*The first two authors contributed equally to this work.

chains, are sufficient to promote early T cell
development (6-8). Although such mice
are still rearrangement-defective, their im-
mature thymocytes (which express neither
the CD4 nor CD8 proteins) begin to express
CD4 and CD8 coreceptors, transcripts of the
TCRo locus become detectable (7), and the
number of thymocytes increases (6-8). In-
troduction of TCRI transgenes into normal
mice suppresses rearrangement of endoge-
nous TCRI genes (9, 10). The TCRI trans-
gene is expressed on the cell surface in the
absence of TCRo proteins in both normal
(11) as well as in rearrangement-defective
mice (7, 8, 12) in an 80-kD disulfied-linked
complex and as a glycosyl-phosphatidylino-
sitol (GPI)-linked 40-kD monomer.

The presence of the TCRI chain in the

80-kD complex suggested that either the
complex was a homodimer or that an un-
known TCR chain was involved that may
affect T cell maturation. A glycosylated
chain of 33 kD (gp33) is paired with TCRI
proteins in a TCRI-transfected immature T
cell line (SCB.29) from severe combined
immunodeficient (SCID) mice (12), but
could not be identified in normal thymo-
cytes (12, 13). The gp33-TCR3 complex of
SCB.29 cells is associated with CD3 pro-
teins (8, 12) and cross-linking of TCR
chains initiates Ca2+ mobilization. This
suggested that this TCRI complex could be
responsible for the developmental progres-
sion observed in TCRI transgenic, rear-
rangement-deficient mice, whereas the
TCRI GPI-linked monomer could repre-
sent a transgenic artifact (14, 15). We have
now cloned the gene encoding gp33 and
examined its structure and expression. Be-
cause of its properties, the gp33 protein was
named the pre-TCROL (pTaO) chain.

Pre-T cell receptor ot (pTot) expression
in immature T cells. The pTa chain can be
identified by two-dimensional (diagonal)
gel electrophoresis, in which the disulfide-
linked pTo protein under reducing condi-
tions migrates away from the diagonal just
undemeath the TCRI protein (12) (Figs. 1
and 2). The analytical method was scaled
up to obtain sufficient amounts of pTot
protein for microsequencing. In a first at-
tempt a 20-amino-acid-long NH2-terminal
sequence was obtained; a peptide of the 18
NH2-terminal residues was synthesized and
injected into rabbits to obtain a pToL-spe-
cific antiserum. The antiserum was tested
for binding to the pTot protein. To this end
lysates from the TCRoL-negative SCB.29
cell line as well as the TCRo3-expressing
B6.2.16BW hybridoma (1 2) were precipi-
tated with the monoclonal antibody (mAb)
F23.1 to V38 proteins (16). Precipitates

1208 SCIENCE * VOL. 266 * 18 NOVEMBER 1994

This content downloaded from 129.2.19.102 on Mon, 16 Sep 2013 14:56:35 PM
All use subject to JSTOR Terms and Conditions

http://www.jstor.org/page/info/about/policies/terms.jsp

• Article Contents

p. 1202
p. 1203
p. 1204
p. 1205
p. 1206
p. 1207
p. 1208

• Issue Table of Contents

Science, New Series, Vol. 266, No. 5188 (Nov. 18, 1994), pp. 1129-1292
Front Matter [pp. 1129-1260]
Editorial: Progress in Japanese Science [p. 1139]
Letters
Risk from Low-Dose Exposures [pp. 1141-1145]
ScienceScope [p. 1147]
News and Comment
Xenotransplants Set to Resume [pp. 1148-1151]
Networking Gene Therapy [p. 1151]
Science and Technology Policy Headed for Political Maelstrom [pp. 1152-1153]
Rivals for Power Lay Down the Law [p. 1153]
At Conference, Hope for Success Is Further Attentuated [p. 1154]
Proposed Global Network for Ecology Data Stirs Debate [p. 1155]
Random Samples [p. 1156]
Research News
Electronic Battle Over Solar Neutrinos [pp. 1157-1158]
Possible Dino DNA Find Is Greeted With Skepticism [p. 1159]
Panel Hopes Compromise Will Bail Out Neutron Source [pp. 1160-1161]
Ninety Ways to be a Mammal [p. 1161]
Dioxins Dominate Denver Gathering of Toxicologists [pp. 1162-1163]
Crowding Innovation Out of Evolution [p. 1163]
Science in Japan: Creating New Structures
[Introduction] [p. 1169]
News
Science Weathers Economic Storm [pp. 1170-1171+1173]
Japan Aims to Link Islands of Science Information [p. 1172]
Universities and Companies Learn Benefits of Teamwork [pp. 1174-1175]
Bright Science City Dreams Face Sober Economic Realities [pp. 1176-1177]
Universities Throw Open Doors to Outside Scrutiny [pp. 1178-1180]
Profile: Chemist Goes Her Own Way [p. 1179]
Profile: A Straight Line to Success [p. 1180]
Japan Learns to Accommodate Its Global Research Partners [pp. 1181-1183]
Profiles: A Sense of What to Look For [p. 1182]
Profiles: Blazing a Collaborative Trail [p. 1183]
Focus on Biotechnology
Agricultural Biotech Blooms Late [pp. 1184-1185]
Profile: Biologist on the Fas(t) Track [p. 1185]
Japan Picks a Winner in the Rice Genome Project [pp. 1186-1187]
Send in the Clones [p. 1187]
MITI Ecoprojects Target the Desert-And the Home Front [p. 1188]
Policy Forum
New Developments in the Science Policy of Japan [pp. 1189-1190]

Perspectives
LTP: Desperately Seeking Resolution [pp. 1195-1196]
How ATP Drives Proteins Across Membranes [pp. 1197-1198]
Composite Fermions in the Quantum Hall Regime [pp. 1199-1202]
The Sverdlovsk Anthrax Outbreak of 1979 [pp. 1202-1208]
Research Article
Analysis and Expression of a Cloned Pre-T Cell Receptor Gene [pp. 1208-1212]
Reports
Ultrahigh-Resolution X-ray Tomography [pp. 1213-1215]
Self-Assembly of n-Alkyl Thiols as Disulfides on Au(111) [pp. 1216-1218]
Growth and Sintering of Fullerene Nanotubes [pp. 1218-1222]
A Phase of Liposomes with Entangled Tubular Vesicles [pp. 1222-1225]
Encapsulation of Guest Molecules into a Dendritic Box [pp. 1226-1229]
DNA Sequence from Cretaceous Period Bone Fragments [pp. 1229-1232]
Circadian Clock Mutants of Cyanobacteria [pp. 1233-1236]
Activation of the Myogenic Lineage by MEF2A, a Factor That Induces and Cooperates with MyoD [pp. 1236-1240]
Two Binding Orientations for Peptides to the Src SH3 Domain: Development of a General Model for SH3-Ligand Interactions [pp. 1241-1247]
A Central Role of Salicylic Acid in Plant Disease Resistance [pp. 1247-1250]
The Role of Hsp70 in Conferring Unidirectionality on Protein Translocation into Mitochondria [pp. 1250-1253]
Modulation of Epithelial Cell Growth by Intraepithelial $\gamma\delta$ T Cells [pp. 1253-1255]
Technical Comments
Diamond-Like Carbon Bonds [pp. 1256-1257]
Book Reviews
Review: The Right Stuff [pp. 1261-1262]
Review: The Return of the Takh [p. 1263]
Review: untitled [pp. 1263-1264]
Review: untitled [p. 1264]
Review: untitled [p. 1264]
Books Received [pp. 1264-1265]
Back Matter [pp. 1266-1292]

Rapidly Progressive, Fatal, Inhalation Anthrax-like
Infection in a Human

Case Report, Pathogen Genome Sequencing, Pathology, and Coordinated Response

Angela M. Wright, MD; Stephen B. Beres, PhD; Erin N. Consamus, MD; S. Wesley Long, MD, PhD; Anthony R. Flores, MD, PhD;
Roberto Barrios, MD; G. Stefan Richter, PhD; So-Young Oh, PhD; Gabriella Garufi, PhD; Hannah Maier, BS;

Ashley L. Drews, MD; Kathryn E. Stockbauer, PhD; Patricia Cernoch, MT; Olaf Schneewind, MD, PhD; Randall J. Olsen, MD, PhD;
James M. Musser, MD, PhD

N Context.—Ten years ago a bioterrorism event involving
Bacillus anthracis spores captured the nation’s interest,
stimulated extensive new research on this pathogen, and
heightened concern about illegitimate release of infectious
agents. Sporadic reports have described rare, fulminant,
and sometimes fatal cases of pneumonia in humans and
nonhuman primates caused by strains of Bacillus cereus, a
species closely related to Bacillus anthracis.

Objectives.—To describe and investigate a case of
rapidly progressive, fatal, anthrax-like pneumonia and the
overwhelming infection caused by a Bacillus species of
uncertain provenance in a patient residing in rural Texas.

Design.—We characterized the genome of the causative
strain within days of its recovery from antemortem cultures
using next-generation sequencing and performed immunohis-
tochemistry on tissues obtained at autopsy with antibodies
directed against virulence proteins of B anthracis and B cereus.

Results.—We discovered that the infection was caused
by a previously unknown strain of B cereus that was closely
related to, but genetically distinct from, B anthracis. The
strain contains a plasmid similar to pXO1, a genetic ele-
ment encoding anthrax toxin and other known virulence
factors. Immunohistochemistry demonstrated that several
homologs of B anthracis virulence proteins were made in
infected tissues, likely contributing to the patient’s death.

Conclusions.—Rapid genome sequence analysis permit-
ted us to genetically define this strain, rule out the like-
lihood of bioterrorism, and contribute effectively to the
institutional response to this event. Our experience strongly
reinforced the critical value of deploying a well-integrated,
anatomic, clinical, and genomic strategy to respond rapidly
to a potential emerging, infectious threat to public health.

(Arch Pathol Lab Med. 2011;135:1447–1459; doi:
10.5858/arpa.2011-0362-SA)

On September 18, 2001, letters containing spores of theAmes strain of Bacillus anthracis were mailed to the
offices of news media. Additional letters containing these
spores, postmarked October 9, 2001, were sent to 2 US
Senators. Five people died, and 17 others were infected
but survived.1–3 This bioterrorism attack resulted in
significant new federal support and controls for research

on so-called select-agent infectious pathogens, such as B
anthracis. Importantly, many new specialized laboratories
were built to facilitate basic and translational research
on select agents. These new facilities, accompanied by
significant support from the National Institutes of Health,
were also designed to improve training and to assist rapid
response to putative or bona fide bioterrorism events o

r

unexpected emergence of new human pathogens.

A decade of accelerated research on B anthracis and the
very closely related organisms Bacillus cereus and Bacillus
thuringiensis have yielded extensive new information
about disease pathogenesis and interspecies and intraspe-
cies genetic variation.4–21 We now know that, compared
with many other bacterial pathogens, relatively little
genetic variation exists among strains of B anthracis
recovered from global sources.6,8 Similarly, many strains
of B cereus and B thuringiensis are also closely related to
one another.7,12–14,17–19 Although most strains of B anthracis
and B cereus are genetically distinct from one another,
genome sequencing and other less-sophisticated genetic
analyses have discovered that certain strains of B cereus
and B thuringiensis are phylogenetically more closely
related to B anthracis than they are to other strains of their
same species designation.12–14 These strains have been
reported to contain genes encoding extracellular molecules

Accepted for publication July 11, 2011.
Published as an Early Online Release August 9, 2011.
From the Department of Pathology and Laboratory Medicine, The

Methodist Hospital System, and the Center for Molecular and
Translational Human Infectious Diseases Research, The Methodist
Hospital Research Institute, Houston, Texas (Drs Wright, Beres,
Consamus, Long, Flores, Barrios, Stockbauer, Cernoch, Olsen, Musser
and Ms Cernoch); the Department of Pediatrics, Section of Infectious
Diseases, Texas Children’s Hospital, Houston (Dr Flores); the Depart-
ment of Microbiology, University of Chicago, Chicago, Illinois, and the
Howard Taylor Ricketts Laboratory, Argonne National Laboratory,
Argonne, Illinois (Drs Richter, Oh, Garufi, and Schneewind and Ms
Maier); and the Department of Medicine, Section of Infectious Diseases,
The Methodist Hospital, Houston (Dr Drews).

The authors have no relevant financial interest in the products or
companies described in this article.

Reprints: James M. Musser, MD, PhD, Department of Pathology and
Laboratory Medicine, The Methodist Hospital System, 6565 Fannin St,
Houston, TX 77030 (e-mail: JMMusser@tmhs.org).

Special Article

Arch Pathol Lab Med—Vol 135, November 2011 Fatal, Anthrax-like Infection—Wright et al 1447

(eg, edema factor, lethal factor, protective antigen [PA],
and capsule) and other virulence factors implicated in
a clinical phenotype with many features of inhalation
anthrax.9,17–22 (In this manuscript, we will refer to this type
of infection as an anthrax-like disease.)

Here, we report the case of fatal, inhalation anthrax-like
disease caused by B cereus in a Hispanic man residing in a
relatively rural area of Texas. Like several other patients
with this type of infection, this patient was a welder.15–17 The
genome of this strain was rapidly characterized by second-
generation DNA sequencing within days of its recovery
from antemortem cultures. The chromosome of the strain is
closely related to a B cereus strain that caused an inhala-
tion anthrax-like disease in San Antonio, Texas, and a B
thuringiensis strain recovered during inspection of a sus-
pected bioweapons facility in Iraq.6,9,17 The strain contains a
plasmid with features similar to virulence plasmids pXO1
and pBCXO1 found in B anthracis and some B cereus strains,
respectively.18 The organism lacks apparent foreign (non-
Bacillus) DNA. The genome data permitted us to effectively
rule out the likelihood of bioterrorism.

MATERIALS AND METHODS

Polymerase Chain Reaction Analysis for B anthracis and B
thuringiensis Genes

Purified genomic DNA from strain B cereus Elc2 was analyzed
for genes encoding protective antigen (pagA), edema factor (cya),
and lethal factor (lef ) encoded by plasmid pXO1 in B anthracis and

pBCXO1 in B cereus strain G9241. Genomic DNA purified from
the Ames strain of B anthracis was used as a positive control. We
also analyzed the strains for the single nucleotide polymorphism
in the plcR gene encoding a pleiotropic regulator of virulence gene
expression.23–25 The relevant region of the plcR gene was amplified
with polymerase chain reaction (PCR) primers custom-designed
for this strain based on the short-read sequencing data and was
characterized by conventional Sanger sequencing using an ABI
3730 instrument (Applied Biosystems [now Life Technologies],
Foster City, California). The cry and cyt genes were analyzed as
previously described.26 The sequences of all PCR primers used in
this study are presented in the Table.

Immunohistochemistry Studies

Histologic sections prepared from tissue obtained at autopsy
were analyzed using rabbit polyclonal antibodies raised against
purified recombinant PA, BslA,27 BcpA1 (BCE_G9241_4758), and
BcpA2 (BCE_G9241_1728).28 Preimmune serum was used as a
negative control. All primary sera were diluted 1:1000, and
horseradish peroxidase–labeled horse anti-rabbit immunoglob-
ulin G (IgG) was used as the secondary antibody (Vector
Laboratories, Burlingame, California).

Cytokine Analysis

Quantitative multianalyte analysis of 89 cytokines, chemo-
kines, and other bioactive molecules was performed on 4 sam-
ples of heparinized plasma collected after the patient was
admitted to the referral institution using the human Multi-Analyte
Profiles immunoassay (MAP v1.6, Rules Based Medicine, Austin,
Texas).

Primers Used to Amplify Genes of Interest

Gene Primer Sequence Use

plcR Forward ATTTATCCATATATTATGCAA plcR gene sequencing for SNP analysis
Reverse TTCACATTATTGTAGTGGTAT

cyt Forward AATACATTTCAAGGAGCTA Identify the presence or absence of the gene
encoding the Bacillus thuringiensis Cyt toxinReverse TTTCATTTTAACTTCATATC

cry Block 1–5 forward TATGCWCAAGCWGCCAATYTWCATYT Identify the presence or absence of the gene
encoding the B thuringiensis Cry toxinBlock 1–5 reverse GGRATAAATTCAATTYKRTCWA

Block 2–5 forward TTTAGATATTGTTGCAWTATKKY
Block 2–5 reverse GGRATAAATTCAATTYKRTCWA
Block 1–4 forward TATGCWCAAGCWGCCAATYTWCATYT
Block 1–4 reverse CATAACGTAGWYTTAYCTKAWT

lef Forward TGCCTTTAATTTATGAGGAAATAAGTAA Identify the presence or absence of the gene
encoding the Bacillus anthracis lethal factorReverse TTTCATATCTTGCCAGCATCCG

pagA Forward GTTATATATTTATAAAAGTTCTGTTTAAAAAGCC Identify the presence or absence of the gene
encoding the B anthracis protective antigenReverse GGTGTCTTGCCTCTGGTG

cya Forward CCATAAAACCGTAAATGTGATTTC Identify the presence or absence of the gene
encoding the B anthracis edema factorReverse TCAAACATGTCGGGGGCATATAA

glpF Forward GCGTTTGTGCTGGTGTAAGT MLST
Reverse CTGCAATCGGAAGGAAGAAG

gmk Forward ATTTAAGTGAGGAAGGGTAGG MLST
Forward 3 GAGAAGTAGAAGAGGATTGCTCATC
Reverse GCAATGTTCACCAACCACAA

ilvD Forward CGGGGCAAACATTAAGAGAA MLST
Reverse GGTTCTGGTCGTTTCCATTC

ilvD_2 Forward AGATCGTATTACTGCTACGG MLST
Forward 4 GCAGAGATTAAAGATAAGGA
Reverse GTTACCATTTGTGCATAACGC

pta Forward GCAGAGCGTTTAGCAAAAGAA MLST
Reverse TGCAATGCGAGTTGCTTCTA

pur Forward CTGCTGCGAAAAATCACAAA MLST
Reverse CTCACGATTCGCTGCAATAA

pycA Forward GCGTTAGGTGGAAACGAAAG MLST
Reverse CGCGTCCAAGTTTATGGAAT

tpi Forward GCCCAGTAGCACTTAGCGAC MLST
Reverse CCGAAACCGTCAAGAATGAT

Abbreviations: cry, Bacillus thuringiensis cytolytic protein; cya, edema factor; cyt, Bacillus thuringiensis crystal protein; glpF, glycerol uptake
facilitator protein; gmk, guanylate kinase; ilvD, dihydroxy-acid dehydratase; lef, lethal factor; MLST, multilocus sequence typing; pagA, protective
antigen; plcR, phospholipase C regulator; pta, phosphate acetyltransferase; pur, phosphoribosylaminoimidazolecarboxamide; pycA, pyruvate
carboxylase; SNP, single nucleotide polymorphism; tpi, triosephosphate isomerase.

1448 Arch Pathol Lab Med—Vol 135, November 2011 Fatal, Anthrax-like Infection—Wright et al

Motility Testing

Motility was assessed by monitoring colony spread after
spotting on a semisolid modified Luria-Bertani agar plate (1%
bactotryptone, 0.3% yeast extract, 0.5% sodium chloride, 0.3%
agar). Motility was scored after incubation overnight at 37uC.

Multilocus Sequence Typing

Multilocus sequence typing (MLST) was done by sequence
analysis of internal fragments of 7 ‘‘housekeeping’’ genes (glpF,
gmk, ilvD, pta, pur, pycA, and tpi)12 (http://pubmlst.org/bcereus,
accessed June 23, 2011). The PCR primers used to amplify the target
gene segments have been described12 and are shown in the Table.

Genome Sequencing and Bioinformatic Analysis of
the Genomes

The genomes of 3 strains derived from antemortem cultures
were sequenced using an Illumina GXII instrument (Illumina,
Inc, San Diego, California), and conditions described previously
for genome studies conducted with group A Streptococcus.29,30

Genome libraries prepared from each strain were uniquely bar-
coded to permit subsequent in silico deconvolution.

Bioinformatic analyses of the genome data were conducted by
methods described previously for group A Streptococcus.29,30 Genetic
content was assessed by analysis of the short-read sequence data
using MOSAIK and EDENA assemblers and Tablet viewer31 (http://
bioinformatics.bc.edu/marthlab/Mosaik, accessed June 23, 2011).
Other specialized genetic analysis methods are described below.

RESULTS

Case Synopsis

The patient, a 39 year-old, previously healthy, Hispanic
man from a rural area of Texas, approximately 75 miles
southwest of Houston, presented to the emergency depart-
ment of a community hospital with a 2-hour history of
shortness of breath, massive hemoptysis, and vomiting. He
was welding at home and had sudden onset of shortness of
breath and cough. After resting briefly, he began experi-
encing hemoptysis and hematemesis with bright red
blood. Review of systems was significant for headache,
light-headedness, substernal chest pain, painful breathing,
and upper abdominal pain. He denied nausea, diarrhea,
sore throat, fever, or chills. He had no previous similar
symptoms or significant medical history and was not
taking prescription medications. He had never smoked
and did not have known exposure to Mycobacterium
tuberculosis.

On arrival at the emergency department of the outlying
hospital, his blood pressure was 93/51 mm Hg, pulse was
115 beats/min, respiratory rate was 20 breaths/min,
tympanic temperature was 98.0uF (36.7uC), and oxygen
saturation was 95% on room air. The patient was alert and
oriented but was anxious and in moderate distress with
copious hemoptysis. Bilateral rales and rhonchi were
noted throughout the lungs, with decreased air move-
ment, more prominent in the right lung than left lung.
There was pleuritic pain on deep inspiration and upper
abdominal tenderness to palpation. No skin lesions were
noted. Laboratory data were noteworthy for the follow-
ing values: white blood cell count of 21 000 cells/mL; a
hemoglobin level of 18.3 g/dL; a hematocrit of 54.5%;
D-dimer and alkaline phosphatase levels of 1574 ng/mL
and 161 mg/mL, respectively; a blood glucose concentration
of 174 mg/dL (to convert to millimoles per liter, multiply
by 0.0555), an aspartate aminotransferase rate of 52 U/L;
a total bilirubin level of 1.1 mg/dL (to convert to micro-
moles per liter, multiply by 17.104); a creatinine level of

1.4 mg/dL (to convert to micromoles per liter, multiply by
88.4); and an abnormally low glomerular filtration rate of
56.42 mL/min. Values for amylase, lipase, creatine kinase,
alanine aminotransferase, and troponin levels and the pro-
thrombin time/partial thromboplastin time were within
reference range. Analysis of the arterial blood gas showed
a pH of 7.42 and values of PCO2, 34.9 mm Hg; PO2,
53.4 mm Hg; bicarbonate, 22.90 mEq/L, and SaO2, 87.8%.
Blood was drawn for cultures.

Chest x-ray and computed tomography (CT) scan
showed multicentric pneumonia with a dense consolida-
tion of the right lung; a small, right pleural effusion; and
perihilar, hazy, nodular infiltrate of the left lung. The
pulmonary vasculature appeared normal. No enlarged
mediastinal lymph nodes were noted. Ceftriaxone, 2 g,
was administered intravenously. Within 3 hours, the
patient’s condition deteriorated with oxygen saturation in
the low 80s% with respiratory rates around 40 breaths/
min. The patient was intubated emergently and trans-
ferred to a tertiary care hospital.

On arrival at the referral hospital, his vital signs were
as follows: blood pressure 102/50 mm Hg, pulse at 144
beats/min, temperature of 96.0uF (35.6uC), and an SaO2 of
98% (FIO2 fraction, 100%). The patient’s condition
worsened after transfer, with blood pressure of 76/
52 mm Hg, a pulse of 133 beats/min, a respiratory rate of 24
breaths/min, and an SaO2 concentration of 79%. Bron-
choscopy was performed, revealing profuse bilateral
alveolar hemorrhage, which was worse in the lower lobes.
The corresponding bronchoalveolar lavage (BAL) was
bloody and showed very high numbers of large, uniform-
ly sized, gram-positive rods that stained with Grocott
methenamine silver stain and contained minimal neutro-
philic reaction (Figure 1, A and B). Many of the bacteria
had a negatively staining halo, suggestive of a capsule
(Figure 1, C). Cultures of the tracheal aspirate, BAL fluid,
and 2 different peripheral blood samples (data not shown
and Figure 1, D) grew a pure culture of gram-positive
rods, identified provisionally as Bacillus species. Urinal-
ysis showed high numbers of red blood cells and white
blood cells, with a moderate number of bacteria present,
but urine cultures were negative for infection. The serologic
test result for human immunodeficiency virus was
negative. A comprehensive autoimmune panel, includ-
ing antinuclear antibody, anti–double-stranded DNA,
perinuclear antineutrophil cytoplasmic antibodies, cyto-
plasmic antineutrophil cytoplasmic antibodies, and anti–
smooth muscle antibody titers, was also ordered, and the
results were later reported to be negative for antibodies.

Approximately 10 hours after initial presentation at
the outlying hospital, the patient remained hypoxic and
hypotensive with multiorgan system failure. He was placed
on venous-venous extracorporeal membrane oxygena-
tion. Methylprednisolone, 1 g intravenously; piperacillin-
tazobactam, 3.375 g every 6 hours; and vancomycin,
1 g every 24 hours, were administered. On day 3, clini-
cal deterioration continued with total opacification of
lungs bilaterally, progression of disseminated intravascular
coagulation, and development of renal failure, rhab-
domyolysis, metabolic acidosis, and abdominal com-
partment syndrome. The clinical microbiology laboratory
presumptively identified the organism as B cereus, resis-
tant to ampicillin and ceftriaxone, and susceptible to
vancomycin and levofloxacin. Ciprofloxacin, 400 mg intra-
venously every 12 hours, was added to the regimen. Later

Arch Pathol Lab Med—Vol 135, November 2011 Fatal, Anthrax-like Infection—Wright et al 1449

that evening, the patient had a decompressive laparotomy,
and a small portion of ischemic small bowel was removed.
The patient expired on hospital day 4, less than 72 hours
after initial presentation to the outlying hospital.

Autopsy Findings: Gross Pathology

An autopsy performed shortly after death revealed
edema of the head, neck, lips, bilateral eyelids, and upper
and lower extremities. There were scattered ecchymoses
and multiple papules ranging in diameter from 0.3 to

1.0 cm on the upper and lower extremities. Multiple
serous fluid–filled vesicular bullae were present on the
right upper extremity, confirmed to be present before
death by medical staff. The heart weighed 440 g (reference
range, 260–360 g) and had a serosanguinous pericardial
effusion (150 mL) and scattered epicardial petechiae. The
lungs were markedly edematous and hemorrhagic bilat-
erally, with a combined fresh weight of 2850 g (reference
range, 700–1000 g). Serosanguinous pleural effusions were
present bilaterally (right, 500 mL; left, 100 mL), despite

Figure 1. Bacillus shown in multiple patient specimens. A, The bronchoalveolar lavage (BAL) fluid contained extremely high numbers of rod-
shaped bacterial organisms adherent to respiratory epithelial cells. Very few polymorphonuclear leukocytes or lymphocytes were observed (BAL
cytocentrifugation preparation). B, Anthracotic pigment is seen alongside the numerous, large, minimally pleomorphic, rod-shaped organisms (BAL
cytocentrifugation preparation). C, Many of the gram-positive rods had a negatively staining halo (black arrows, left and right panels) suggestive of a
capsule (BAL test). D, Blood collected from multiple anatomic sites grew a pure culture of gram-positive rods with similar morphology, including the
presence of a thick capsule (black arrows), to organisms observed in the direct specimens (Papanicolaou stain, original magnifications 320 [A] and
3100 [B]; Gram stain, original magnifications 3100 [C and D]).

1450 Arch Pathol Lab Med—Vol 135, November 2011 Fatal, Anthrax-like Infection—Wright et al

well-positioned and patent bilateral chest tubes, and the
right lung had extensive pleural adhesions. No gelatinous
edema of the mediastinum was present. The tracheobron-
chial tree was hyperemic. The liver was diffusely mottled
with extensive fatty change, congestion, and necrosis.
There was mild splenomegaly with a spleen weight of
220 g (reference range, 125–195 g). The greater curvature
of the stomach, small intestine, and large intestine had
patchy, dusky ischemic changes with mucosal necrosis.
The kidneys had mildly congested medullae. The prostate
was diffusely dusky, and there was significant scrotal
edema. The brain weighed 1470 g, had subarachnoid
hemorrhages, and was edematous. Cultures were ob-
tained from bilateral lung parenchyma, bilateral pleural
fluid, blood, kidney, liver, spleen, hilar lymph nodes, and
bullous skin lesion fluid. All specimens, except the skin
lesion fluid, grew a B cereus–like organism. Cryptococcus
neoformans grew in cultures from the right upper lobe lung
parenchyma and in blood drawn from the aorta.

Autopsy Findings: Histopathology

Representative sections from the lung, stained with
hematoxylin–eosin, had extensive areas of necrosis, hemor-
rhage, and intra-alveolar edema (Figure 2, A and B). The
alveolar septa showed necrosis, and the alveolar airspaces
contained focal alveolar macrophages, including some with
anthracotic pigment. The bronchi, bronchioles and mem-
branous bronchioles had denuded epithelium and exten-
sive wall hemorrhage (Figure 2, A and B). Consistent with
the imaging studies and gross pathology examination, the
right lung was more severely affected than the left lung.
Many gram-positive, rod-shaped bacteria were present in
the alveolar spaces and the pleura (Figure 2, C and D).
These bacteria were seen in the hematoxylin-eosin sections
of all lung lobes, most prominently in the right upper lobe.
Many of the bacteria had a negatively staining halo,
suggestive of a capsule (Figure 2, E). Edema, hemorrhage,
and mild, acute and chronic inflammation were also
identified in the pleura, extending into the interlobular
septa (Figure 2, F). The tracheal mucosa was necrotic with
denuded epithelium, and the mucosal surface had diffuse
hemorrhage with fibrin deposits and groups of acute
inflammatory cells.

The splenic red pulp was expanded and congested, with
prominent hemophagocytosis (Figure 3, A and B). There
was an increase in immature, hypolobated eosinophils.
Lymphoid follicles were sparse and no collapse of
germinal centers was noted, which has been reported in
humans and nonhuman primates with inhalation an-
thrax.3,10 No evidence of hematologic malignancy was
observed.

Several organs showed findings potentially related to
hemodynamic compromise and lack of perfusion. For
example, sections of the gastrointestinal tract, including
stomach, small bowel, and large bowel, had changes
consistent with ischemia, including patchy areas of muco-
sal, coagulative necrosis with underlying congestion
and edema. Focal areas of organisms morphologically
consistent with Candida species were seen in the
ischemic stomach epithelium. Acute tubular necrosis
was present in both kidneys with widespread, coagula-
tive necrosis of the tubules, predominately proximal,
whereas other tubules showed prominent vacuolization
(Figure 3, C). Some collecting ducts contained blood and
inflammatory cells. Focal fibrin thrombi were also seen

in some of the glomeruli. The adrenal glands showed
diffuse cortical congestion with hemorrhage and necro-
sis. The liver had sheets of necrosis and diffuse sinu-
soidal congestion (Figure 3, D). Areas of viable hepato-
cytes had macrovesicular and microvesicular steatosis.
No significant inflammation was present in the portal
triads. No increased fibrosis, increased iron stores, or
globules positive for periodic acid–Schiff were revealed
by special stains. The heart showed focal, recent hemor-
rhage. The prostate parenchyma had focal glandular
necrosis.

Conventional Microbiologic Characterization

All isolates cultured from patient samples were b-
hemolytic on blood agar plates, and the colonies had a
ground-glass appearance. The organisms also grew on
chocolate agar and were positive for catalase and
lecithinase. The organism was susceptible to vancomycin
and levofloxacin and was resistant to ampicillin and
ceftriaxone. All organisms were presumptively identified
as B cereus based on these criteria. The BD Phoenix
Automated Microbiology System (BD Diagnostic Systems,
Sparks, Maryland) identified the organism as B cereus.
The organisms were motile, as assessed by growth in
semisolid agar, and encapsulated, as shown by India ink
staining (Figure 4, A and B).

Cytokine, Chemokine, and Biomarker Analysis

The host response to the severe pneumonia and
overwhelming sepsis was assessed by measuring 89
cytokines, chemokines, and biomarkers in 4 plasma
samples collected for routine diagnostic procedures at
approximately 24-hour intervals after the patient was
transferred to the referral institution. Consistent with the
clinical impression and autopsy findings, the data were
consistent with a vigorous systemic response. Granulo-
cyte colony stimulating factor (approximately 300-fold),
interleukin-10 (approximately 40-fold), interleukin-1
receptor antagonist (approximately 35-fold), myeloperox-
idase (approximately 18-fold), CD40 antigen (approxi-
mately 3-fold), and interleukin-16 (approximately 2-fold)
were markedly elevated (relative to the upper limit of
their reference range) in each sample tested. Also
consistent with previous reports of biomarkers measured
in patients with sepsis and in animal models of inhala-
tional anthrax, there were increased plasma levels of
endothelin-1 (ET-1), tissue inhibitor of metalloproteinase 1
(TIMP-1), macrophage inflammatory protein-1a, and
macrophage inflammatory protein-1b. Possibly explain-
ing the numerous immature, eosinophilic leukocytes
observed in the spleen tissue collected at autopsy,
eotaxin-1, a chemoattractant of eosinophils, was elevated
(approximately 5-fold). Also consistent with the clinical
diagnosis of disseminated intravascular coagulation,
clotting factor I (fibrinogen) and factor VII (proconvertin)
were decreased, and type-1 plasminogen activator inhib-
itor 1 was markedly elevated.

Genome Sequencing and Bioinformatic Analysis

The investigative group evaluated all available clinical
and pathology data the morning after the autopsy was
performed, and the literature was reviewed. Initial PCR
analysis of the isolate recovered from the antemortem
blood culture revealed that the organism had the genes
encoding PA and lethal factor. Four main possibilities

Arch Pathol Lab Med—Vol 135, November 2011 Fatal, Anthrax-like Infection—Wright et al 1451

Figure 2. The autopsy confirmed the diagnosis of severe pneumonia and sepsis. A, The alveolar septa are moderately thickened and congested. Edema,
hemorrhage, and mild inflammation were also identified in the pleura, extending into the interlobular septa. B, Microscopic examination of all lung
lobes, particularly the right upper lobe, demonstrates extensive edema and hemorrhage within both the alveolar and bronchial air space. Many rod-
shaped bacteria and very few acute inflammatory cells were identified at higher magnification. C, Extremely high numbers of gram-positive bacteria in
the lung. D, Although most of the organisms were strongly gram-positive, a small subset showed a gram-variable staining pattern. E, Many of the
organisms had a negatively staining halo (black arrows) suggestive of a capsule. F, Bacteria (white arrows) were also present in the pleura (hematoxylin-
eosin, original magnifications 32 [A], 340 [B], and 3100 [E and F]; Gram stain, original magnifications 310 [C] and 3100 [D]).

1452 Arch Pathol Lab Med—Vol 135, November 2011 Fatal, Anthrax-like Infection—Wright et al

were considered, including that the strain was (1) a con-
ventional (common) B cereus organism, (2) a natural
variant of B cereus that produces one or more anthrax-
related toxins, (3) an unusual natural variant of B anthracis,
or (4) a human-engineered form of one of these two spe-
cies or another closely related species, such as B thurin-
giensis. The PCR results effectively ruled out possibility (1)
above. We concluded that the only definitive way to
differentiate among the remaining 3 possibilities was to
sequence the genome of the causative organism. Given the
substantial public health and biosecurity implications of
several of these possibilities and the on-site genomics capa-
city and expertise of the Houston investigative group,29,30

we also concluded that the effort and cost required to
sequence the genomes were very well justified.

Three isolates were chosen for analysis, including one
organism each grown from antemortem blood, tracheal
aspirate, and BAL specimens obtained at the referral
hospital. We chose to sequence the genome of 3 isolates
initially predominantly as a hedge against an isolated
technical problem resulting in the lack of genome se-
quence data if only one isolate were processed for analysis.

We also opted to have 2 experienced investigators (S.B.B.
and A.R.F.) create the sequencing libraries independently,
also as a hedge against an unanticipated technical prob-
lem. A second reason for sequencing the genomes of 3
separate isolates was our interest in beginning to assess the
degree, if any, of genome sequence divergence in orga-
nisms recovered from distinct anatomic sites. Intrahost
genetic variation is well known to occur in certain RNA
viruses, such as the human immunodeficiency virus,32 and
has also been described in the highly polymorphic gene
encoding the streptococcal inhibitor of the complement
secreted by group A Streptococcus.33 However, that issue
has not been assessed at the full-genome level in bacterial
isolates cultured at the same time from different sites of
one patient.

Generation of the genome sequence data with an Illu-
mina GXII instrument was completed 8 days after the
autopsy and 6 days after the decision was made to per-
form this analysis. The genome analysis run yielded
approximately 4 000 000 to 5 000 000 reads of high-quality
sequence data for each isolate (total of 23 964 180 high-
quality reads for the 6 strain libraries). We focused our

Figure 3. The autopsy examination identified histologic features of severe, disseminated infection and generalized hypoperfusion. A, The splenic red
pulp was markedly expanded, and the white pulp was paucicellular with depletion of lymphocytes and germinal centers. B, Numerous monolobated,
immature, eosinophilic leukocytes (black arrows, left panel) and prominent hemophagocytosis (white arrows, right panel) were observed in the spleen.
C, Mild congestion and acute tubular necrosis were observed in the kidney. D, Congestion, patchy necrosis, and microvesicular and macrovesicular
steatosis were present in the liver (hematoxylin-eosin, original magnifications 310 [A and D], 3100 [B], and 340 [C]).

Arch Pathol Lab Med—Vol 135, November 2011 Fatal, Anthrax-like Infection—Wright et al 1453

initial bioinformatic analyses on the genome data obtained
for the isolate recovered from the blood culture performed
when the patient arrived at our facility. Of note, the
greatest number of high-quality reads (5 159 932) was
generated for this isolate. This organism was designated
Elc2. Reads were mapped to all B anthracis (n 5 5 strains),
B cereus (n 5 10 strains), and B thuringiensis (n 5 5 strains)
reference sequences available in the National Center for
Biotechnology Information Complete Microbial Genome
Database. The Elc2 shared the greatest similarity, in
increasing order, to reference genomes of B anthracis
Ames Ancestor (Amerithrax event),2 B cereus 03BB102
(fatal pneumonia, San Antonio, Texas),16 and B thuringien-
sis Al Hakam, recovered in a suspected bioweapons
facility in Iraq.9 The data (Figure 5, A through C) showed
that approximately 77% of reads mapped to the reference
chromosome of each of these B cereus and B thuringiensis
isolates, whereas only about 70% of the reads mapped to
the chromosome of the B anthracis reference. The pattern
of mapped reads (Figure 5, A) was consistent with the
idea that the Elc2 isolate lacked 3 of the 4 prophages
invariantly reported in the chromosome of the Ames

Ancestor and all other B anthracis strains.34,35 The pattern
more closely resembled that expected for either of the
other 2 reference genomes analyzed (B cereus O3BB102
and B thuringiensis Al Hakam) (Figure 5, B and C). We
next mapped the DNA sequencing reads to plasmids
found in each of these 3 reference genomes and the
additional one of B cereus strain G9241, which was isolated
from a patient with a fatal inhalation anthrax-like infection
in Louisiana in 1994.15,16 Consistent with the PCR ampli-
fication of lef, cya, and pagA gene segments, 11.3% of the
Elc2 sequence library reads mapped to pXO1, the plasmid
that encodes these critical B anthracis virulence factors
(Figure 5, D). Similarly, 11.4% of all reads mapped to
pBCXO1, a toxin-encoding plasmid found in B cereus
G9241 that is 99.6% identical to pXO1. However, exceed-
ingly few of the reads (0.05%) mapped to pXO2 (Figure 5,
E), and 0.76% mapped to pBC218, a large plasmid in B
cereus strain G9241 that is required for full virulence in
mouse infection.20 These results suggest that Elc2 has a
pXO1-like plasmid that encodes the tripartite anthrax
exotoxin but lacks a pX02-like plasmid, a finding also
supported by PCR (Figure 5, F). We note that the higher
fold-coverage of the plasmid data relative to the chromo-
somal data (350 coverage for the reads mapped to the
chromosome of either B cereus 03BB102 or B thuringiensis
Al Hakam, compared with 3200 coverage for the reads
mapped to either pXO1 or pBPXO1) (Figure 5) suggests
that the Elc2 isolate contained a higher proportion of
plasmid copies relative to the chromosome.

Five different MLST schemes have been developed for
the B cereus group of related organisms.5 More than 1100
strains have been analyzed by these methods, resulting in
large public databases (http://mlstoslo.uio.no/ and http://
pubmlst.org/bcereus/, accessed on June 23, 2011). We
performed MLST analysis on Elc2, first by analyzing the
genomic data, and subsequently, by Sanger-sequencing
internal fragments of 7 housekeeping genes (glpF, gmk, ilvD,
pta, pur, pycA, and tpi).12 We discovered that the MLST of the
Elc2 isolate was identical to B cereus MLST sequence type
ST108 at all 7 of these loci (Figure 6). Importantly, ST108 is
closely related to B anthracis strains and several B cereus and
B thuringiensis strains that have caused fatal cases of
fulminant pneumonia.

A key single nucleotide polymorphism that differenti-
ates all B anthracis strains from closely related organisms,
such as B cereus, is a nonsense mutation in the gene (plcR)
encoding a pleiotropic virulence regulator that controls
expression of a large number of virulence factors.23,24 This
single nucleotide polymorphism creates a premature stop
codon in B anthracis, whereas the other closely related
Bacillus strains have a wild-type allele. Thus, we next
analyzed the DNA sequencing data using MOSAIK
(http://bioinformatics.bc.edu/marthlab/Mosaik, accessed
June 23, 2011) to determine the plcR allele present in Elc2.
The data suggested that Elc2 had the wild-type plcR allele,
a finding that was confirmed by conventional Sanger
sequencing of the relevant PCR-amplified region of the plcR
gene (data not shown). Subsequent analysis of the genome
sequencing data for the isolates cultured from the BAL and
tracheal aspirate by these same methods confirmed the
above findings and conclusions (data not shown).

A complete description of the genome of this Bacillus
organism will be presented elsewhere (manuscript in
preparation).

Figure 4. Phenotypic characterization of Bacillus cereus strains
recovered from the patient. A, India ink stain showing capsule
production by Bacillus strains. Images for the Elc isolates suggest a
mixed population with encapsulated and unencapsulated forms
(original magnification 3100). B, Motility assay from growth on
semisolid agar. Abbreviations: 14579, B cereus strain American Type
Culture Collection (ATCC) 14579; Ames, Bacillus anthracis Ames
strain; G9241, B cereus strain G9241; Elc2, Elc3, Elc4, three B cereus
isolates cultured from different specimens of the source patient. The
strain designations are the same in both A and B.

1454 Arch Pathol Lab Med—Vol 135, November 2011 Fatal, Anthrax-like Infection—Wright et al

Immunohistochemical Studies

Immunohistochemical study of tissues obtained from
patients infected during the 2001 anthrax attack showed
that several well-known extracellular anthrax virulence
factors are made in vivo.3 However, analogous studies of
patients with fulminant B cereus or B thuringiensis infec-
tions have not been conducted. Inasmuch as the genome
analyses found that the infecting strain had genes encod-
ing several extracellular virulence molecules produced by
anthrax, we tested the hypothesis that these factors were
made in vivo in this patient. Consistent with the hypoth-
esis, immunohistochemical analysis of specimens pre-
pared from multiple lung lobes revealed material reactive
with specific rabbit antibodies raised against purified PA;
BslA, an extracellular protein involved in adhesion of B
anthracis to host cells27; and the pilin subunits BcpA1
and BcpA228 (Figure 7, A through D). No reactivity was
observed in any tissue section treated with preimmune
(control) sera (Figure 7, E).

COMMENT

Strains of B cereus and close genetic relatives that
cause fulminant pneumonia and other severe invasive
infections in humans and wild chimpanzees have been
described.17–19,36,37 Although exceedingly rare, infections in
humans attract significant interest because they can mimic
some clinical features of anthrax, thereby raising substan-
tial public health and bioterrorism concerns. This patient,
like several others described in the literature,16,17 was a
welder living in a relatively rural area. The explanation for
the strong association between a history of welding and
other forms of metalwork, rural environments, and Texas
and Louisiana16,17,36 is not known, but welding can pre-
dispose a person to severe lung infections.38 The fulminant
course of this patient’s infection, together with the growth
of C neoformans from the lung parenchyma and his human
immunodeficiency virus–negative status, suggest that an
underlying pulmonary defense dysfunction contributed
to disease pathogenesis.

Our study adds to the concept that rapid, full-genome
analysis of microbial pathogens is an important compo-
nent of contemporary infectious diseases response and
investigation.39,40 Full-genome analysis is an especially
important issue for pathogens with significantly restricted
levels of naturally occurring genetic variation, such as B
anthracis and related organisms. The ability to sequence
bacterial genomes economically and accurately, and to
define isolates based on all gene content and genetic

Figure 5. Genetic analysis of Bacillus strain Elc2 cultured from blood.
Approximately 5 000 000 high-quality sequencing reads were obtained
from Bacillus strain Elc2 cultured from the blood of the patient. The
DNA sequencing was done with an Illumina GXII instrument (Illumina,
Inc, San Diego, California). The reads were electronically mapped to
all 20 available Bacillus group genomes (B anthracis, B cereus, B
thuringiensis, B mycoides, and B weihenstephanensis) deposited in
the National Center for Biotechnology Information Complete Micro-
bial Genome Database (Available at: http://www.ncbi.nlm.nih.gov/
genomes/lproks.cgi, accessed June 23, 2011) using Mosaik. Shown are
depth-of-coverage plots for the Elc2 short-read sequences mapped to
the indicated reference chromosomes for B anthracis Ames Ancestor
(A), B cereus 03BB102 (B), B thuringiensis Al Hakam (C), the B
anthracis plasmid pXO1 that encodes the tripartite anthrax toxin (D),
and the B anthracis plasmid pXO2 that encodes a poly-D-glutamic acid
capsule (E). Text in figure shows the percentage of the total
approximately 5 million sequencing reads that mapped to each
chromosome or plasmid. The x-axis refers to the position along the

r

.5 000 000-bp (5 Mbp) chromosome of each strain or plasmid (kbp,
kilobase pair). The panel for the Ames Ancestor strain shows the
location of 4 prophages on the x-axis. Also shown on the y-axis are the
fold-coverage values for the chromosomes and the plasmids. The Elc2
reads, mapped throughout the pXO1 sequence, demonstrate the
presence of a pXO1-family plasmid in the Elc2 genome. Inspection of
the Elc2 reads mapped to pXO1 showed deep coverage across the cya,
lef, and pagA genes encoding anthrax toxins edema factor, lethal factor,
and protective antigen, respectively. Very few reads mapped to plasmid
pXO2 (E). Displayed in (F) is an agarose gel image with polymerase
chain reaction–amplified products corresponding to genes (cya, lef, and
pagA) encoding B anthracis toxins. There was very high, mean fold-
coverage for the Ames Ancestor chromosome (45-fold to 50-fold [A])
and plasmid pXO1 (about 200-fold [D]).

Arch Pathol Lab Med—Vol 135, November 2011 Fatal, Anthrax-like Infection—Wright et al 1455

variation, permits rapid elucidation of close genetic rela-
tives. In the context of this event, the full-genome data
permitted us to effectively rule out the likelihood of
bioterrorism. That is, the genome data revealed no evi-
dence that this organism had been genetically altered in
the laboratory for malicious purposes. We will report
elsewhere, in more detail, findings related to the genomic

analysis of this organism and to the intrahost genetic
variation identified by our studies.

Many of the autopsy findings in this patient echo
several of the gross and histopathologic features described
in the inhalational anthrax attack cases occurring in
20013,11 and the Sverdlovsk outbreak.41 For example, the
anthrax patients had abundant serosanguinous fluid

Figure 6. Estimates of genetic relationships among Bacillus group strains. The estimates are based on multilocus sequence type data obtained for 7
loci, analyzed by the neighbor-joining method. The left side shows a dendrogram with 3 main genetic clades that are color-coded in green (top), red
(middle), and blue (bottom). The right side shows an expanded view of the portion of the dendrogram containing the sequence types corresponding
to Bacillus anthracis strains (top) and to organisms most closely related to the B anthracis strains (bottom). The fuchsia-colored numbers at the end of
the branches of the dendrogram refer to sequence types using the nomenclature found at the multilocus sequence typing (MLST) Web site (http://
pubmlst.org/bcereus, accessed June 23, 2011), based on the 551 sequence types present in this database. Strains for which full-genome sequence
data are available in public databases are shown in the dendrogram. Strain Bacillus cereus Elc2 is sequence type 108, as shown, and is part of a
genetic cluster that is most closely related to Bacillus thuringiensis strain Al Hakam, recovered in Iraq from a suspected bioweapons facility, and B
cereus strain 03BB102 isolated from a fatal human inhalation anthrax-like case that occurred in San Antonio, Texas, in 2004. The Elc2 is very closely
related to sequence type 62 strain 03BB108 shown in grey. The 03BB108 strain was isolated from the environment in San Antonio, Texas, in
association with the inhalation anthrax-like case (its genome sequence has not been determined). Abbreviations: Ba, B anthracis; Bc, B cereus; Bt,
B thuringiensis.

Figure 7. Immunohistochemistry demonstrates in vivo production of virulence factors protective antigen (A), BslA (B), BcpA1 (C), and BcpA2 (D)
in lung tissue obtained at autopsy. No staining was observed in the negative control lung tissue, stained with preimmune rabbit antiserum (E)
(immunoperoxidase stain, original magnifications 3100 [A through D]; original magnification 3100 [E]).

1456 Arch Pathol Lab Med—Vol 135, November 2011 Fatal, Anthrax-like Infection—Wright et al

within the pleural cavities, a feature also observed in this
patient despite placement of bilateral chest tubes. Simi-
larly, lung sections from the cases in 2001 and our patient
had hemorrhage and edema of the pleura and interlobular
septa, intra-alveolar edema, bacteria in the pleura, and
lack of significant intra-alveolar inflammatory infiltrate.
Splenic changes in this Texas patient included congestion
and presence of immunoblasts, as was reported in the
anthrax cases. Although 2 of the 8 patients (25%) de-
scribed in the anthrax series had cutaneous lesions,3 the
prominent bullous lesions observed on the right upper
extremity observed in our patient appear to be a distinc-
tive feature. Serous fluid obtained from these skin lesions
during autopsy showed moderate numbers of gram-
positive rods. No growth occurred in culture, perhaps
because the patient was treated aggressively with antimi-
crobial agents to which the isolate was susceptible. The
precise molecular etiology of these cutaneous lesions
remains unclear.

Very little is known about the molecular pathogenesis of
these rare cases of fulminant infection caused by B cereus
and related highly virulent strains. Two recent publica-
tions20,21 have analyzed contributory bacterial factors in
mouse models of infection. Although presumably some of
the mouse pathology was caused by in vivo expression of
extracellular toxins and other bacterial molecules (likely
analogous to anthrax molecular pathogenesis), this issue
had not been addressed in human patients. Importantly,
our immunohistochemistry studies discovered that PA,
BslA, BcpA1, and BcpA2 were made in vivo in this patient
(Figure 7). As the elaboration of pili from pilin subunits
(BcpA1 and BcpA2) is a feature of B cereus strains, but not
of B anthracis, these findings further corroborated the idea
that this patient’s infection was not caused by a bona fide
B anthracis strain. Toxin-expressing B cereus and B anthracis
strains elaborate capsules, which are essential for the
pathogenesis of anthrax and inhalation anthrax-like
disease. Bacillus anthracis makes a capsule composed of
poly-g-D-glutamic acid and can be identified with the
antibody specific for poly-g-D-glutamic acid. Proteins
responsible for poly-g-D-glutamic acid synthesis are
encoded by genes on the pXO2 virulence plasmid. In
contrast, B cereus isolates with pBCXO1 use the hasACB
operon to synthesize a hyaluronic acid capsule that can be
removed from the cell surface by treatment with hyal-
uronidase. India ink staining of B cereus Elc isolates
revealed the presence of a capsule (Figure 4). Additional
studies are underway to determine the composition of the
capsule and to further assess the in vivo gene transcription
and virulence factor production by the B cereus Elc
isolates.

A confluence of circumstances aided the rapid and
efficient response to this event. We believe it is instructive
to share several items that may be useful to consider when
future analogous clinical situations occur. First, the patient
was admitted to our hospital during the period when a
very large outbreak of Escherichia coli O104:H4 hemor-
rhagic colitis and fatal hemolytic uremic syndrome was
occurring in Germany and elsewhere in Europe.42,43 This E
coli public health problem had led several members of our
pathology department to discuss how we might respond
if one of our 5 system hospitals were the epicenter of a
similar infection outbreak. Fortuitously, this discussion
had occurred less than 24 hours before we became aware
of this patient’s circumstances. Thus, many aspects of a

laboratory and other response plan, including the geno-
mic analysis strategy, had been considered very recently.
A second factor that assisted the efficiency of our response
was that one of us (J.M.M.) serves as the chair of the
Department of Pathology and Laboratory Medicine and
has expertise in clinical microbiology and a strong interest
and background in genome-scale analysis of microbial
pathogens.29,30 These factors, coupled with the institutional
availability of a next-generation sequencing instrument
and in-house bioinformatics expertise,29,30 meant that we
had the capacity to rapidly sequence and analyze the
genome of the causative organism. Thus, the strain
analysis component of the response proceeded efficiently
in our Houston facility. That is, there was no need to
outsource the genomic analysis (such as was necessary in
the recent European E coli O104:H4 outbreak), thereby
saving critical time. Importantly, although not available
at our institution, new types of next-generation sequenc-
ing39,44 would have further decreased the time required
for rapid genome analyses, and thus, would have been
especially useful. Increased speed of genetic analysis is of
special importance in cases like this involving potential
bioterrorism or other events with considerable public-
health implications occurring in large hospitals in major
metropolitan areas.

The initial hints that the patient was infected with an
unusually virulent Bacillus occurred during the micro-
scopic examination of the BAL and microbiology labora-
tory workup of the gram-positive organism recovered
from all of the patient’s specimens. The striking abun-
dance of gram-positive bacilli and corresponding paucity
of expected, acute inflammation in the antemortem BAL
led the pathology resident and attending cytopathologist
to suspect something badly awry in this patient. Simul-
taneously, a medical technologist in the clinical microbi-
ology laboratory raised concern about the pure and
luxuriant growth of an organism presumptively identified
as B cereus in all specimens. Within 24 hours, the same
resident performed the autopsy. Knowledge of the BAL
results and preliminary microbiology data, combined
with the highly unusual clinical presentation and rapid
demise, prompted the resident to conduct an extensive
review of the patient’s medical record. All available
clinicians, consultants, nurses, and microbiology person-
nel were contacted to obtain additional clinical details and
impressions. Inasmuch as some of the autopsy findings
were similar to inhalational anthrax cases and the patient
was a welder, this crucial information informed our search
for, and subsequent discovery of, a small number of
similar cases reported in the literature.

Part of the response to the event included a discussion
of whether to offer antimicrobial agent prophylaxis to
close contacts. To our knowledge, there has been no report
of secondary transmission to hospital staff or family in
patients infected with these B cereus anthrax-like organ-
isms. However, given the fulminant course of the patient,
the existence of so few comparable cases, the unknown
likelihood of transmission, and the comparatively low risk
associated with antimicrobial prophylaxis, it was ultimate-
ly decided to offer prophylaxis to anyone intimately
involved with the patient who may have been exposed to
his respiratory secretions. To date, no cases of secondary
transmission have occurred.

One additional key point assisted the efficiency of our
response to this patient’s infection. We concluded early

Arch Pathol Lab Med—Vol 135, November 2011 Fatal, Anthrax-like Infection—Wright et al 1457

in the investigation that it was important to engage
experienced anthrax investigators in collaborative studies.
All local and national investigators we contacted gener-
ously assisted our studies. Because of the concentration of
expertise, we opted to collaborate with investigators at the
Great Lakes Regional Center of Excellence for Biodefense
and Emerging Infectious Diseases, administratively based
at the University of Chicago, Illinois. A request for collab-
orative interaction was made, very rapidly approved, and
an investigative strategy was developed within hours.
This center has particular extensive expertise with B
anthracis and unusually virulent B cereus, and thus, was a
logical choice for providing specialized assistance. Ar-
rangements were made to exchange strains and serologic
reagents, a process that greatly assisted the efficient
response to this event.

CONCLUSION

One of us (J.M.M.) recently proposed the inception of a
third training track in pathology termed genomic pathol-
ogy,45 designed to complement the traditional anatomic
and clinical pathology tracks. As the introgression of
genome-scale analyses proceeds rapidly and inexorably
into contemporary patient care and pathology practice,
the career opportunities for this new type of trainee will
increase considerably, and new patient-care niches will be
created. We believe cases such as this highlight the need
for, and potential utility of, a cadre of pathologists trained
and facile in genomic pathology.

We gratefully acknowledge the important contributions of
J. Lister, MT, L. Schwartz, JD, K. Bernal, JD, and G. Land, PhD, to
the success of the project; J. L. Wimmer, MD, and A. Sexton, BS,
for assistance with the autopsy; C. M. Leugers, MD, and F. R.
DeLeo, PhD, for suggestions to improve the manuscript; R.
Gonzalez, BS, for help with the histopathology; T. Le, BS, and
B. A. Gutierrez-Grebenkova, BS, for assistance with MLST; R.
Anton, MD, A. Ewton, MD, S. Z. Powell, MD, and D.
Weilbaecher, MD, for review of histopathology material; P. T.
Cagle, MD, for encouragement; T. M. Koehler, PhD, and T. G.
Hammerstrom, BS, for anthrax-toxin gene primers; and S. Ayers,
PhD, for assistance with genome-sequencing logistics. We
would also like to note that Drs Wright, Beres, Consamus, and
Olsen contributed equally to this work.

References

1. Jernigan JA, Stephens DS, Ashford DA. Bioterrorism-related inhalation
anthrax: the first 10 cases reported in the United States. Emerg Infect Dis. 2001;
7(6):933–944.

2. Jernigan DB, Raghunathan PL, Bell BP, et al. Investigation of bioterrorism-
related anthrax, United States, 2001: epidemiologic findings. Emerg Infect Dis.
2002;8(10):1019–1028.

3. Guarner J, Jernigan JA, Shieh W-J, et al. Pathology and pathogenesis of
bioterrorism-related inhalation anthrax. Am J Pathol. 2003;163(2):701–709.

4. Han CS, Xie G, Challacombe JF, et al. Pathogenomic sequence analysis of
Bacillus cereus and Bacillus thuringiensis isolates closely related to Bacillus
anthracis. J Bacteriol. 2006;188(9):3382–3390.

5. Kolsto A-B, Tourasse NJ, Okstad OA. What sets Bacillus anthracis apart
from other Bacillus species? Annu Rev Microbiol. 2009;63:451–476.

6. Papazisi L, Rasko DA, Ratnayake S, et al. Investigating the genome diversity
of B. cereus and evolutionary aspects of B. anthracis emergence. Genomics.
2011;98(1):26–39.

7. Helgason E, Okstad OA, Caugant DA, et al. Bacillus anthracis, Bacillus
cereus, and Bacillus thuringiensis – one species on the basis of genetic evidence.
Appl Environ Microbiol. 2000;66(6):2627–2630.

8. Keim P, Gruendike JM, Klevytska AM, et al. The genome and variation in
Bacillus anthracis. Mol Aspects Med. 2009;30(6):397–405.

9. Challacombe JF, Altherr MR, Xie G, et al. The complete genome sequence
of Bacillus thuringiensis Al Hakam. J Bacteriol. 2007;189(9):3680–3681.

10. Stearns-Kurosawa DJ, Lupu F, Taylor FB Jr, Kinasewitz G, Kurosawa S.
Sepsis and pathophysiology of anthrax in a nonhuman primate model. Am J
Pathol. 2006;169(2):433–444.

11. Shieh WJ, Guarner J, Paddock C, et al. The critical role of pathology in the
investigation of bioterrorism-related cutaneous anthrax. Am J Pathol. 2003;163(5)
1901–1910.

12. Priest FG, Barker M, Baillie LWJ, et al. Population structure and evolution
of the Bacillus cereus group. J Bacteriol. 2004;186(23):7959–7970.

13. Barker M, Thakker B, Priest FG. Multilocus sequence typing reveals that
Bacillus cereus strains isolated from clinical infections have distinct phylogenetic
origins. FEMS Microbiol Lett. 2005;245(1):179–184.

14. Kim K, Cheon E, Wheeler KE, et al. Determination of the most closely
related Bacillus isolates to Bacillus anthracis by multilocus sequence typing. Yale
J Biol Med. 2005;78(1):1–14.

15. Miller JM, Hair JG, Hebert M, Hebert L, Roberts FJ Jr. Fulminating
bacteremia and pneumonia due to Bacillus cereus. J Clin Microbiol. 1997;35(2):
504–507.

16. Avashia SB, Riggins WS, Lindley C, et al. Fatal pneumonia among
metalworkers due to inhalation exposure to Bacillus cereus containing Bacillus
anthracis toxin genes. Clin Infect Dis. 2007;44(3):414–416.

17. Hoffmaster AR, Hill KK, Gee JE, et al. Characterization of Bacillus cereus
isolates associated with fatal pneumonias: strains are closely related to Bacillus
anthracis and harbor B. anthracis virulence genes. J Clin Microbiol. 2006;44(9):
3352–3360.

18. Hoffmaster AR, Ravel J, Rasko DA, et al. Identification of anthrax toxin
genes in a Bacillus cereus associated with an illness resembling inhalation
anthrax. Proc Natl Acad Sci U S A. 2004;101(22):8449–8454.

19. Klee SR, Brzuszkiewicz EB, Nattermann H, et al. The genome of a Bacillus
isolate causing anthrax in chimpanzees combines chromosomal properties of B.
cereus with B. anthracis virulence plasmids. PLoS One. 2010;5(7):e10986.

20. Oh S-Y, Budzik, JM, Garufi G, Schneewind O. Two capsular polysaccha-
rides enable Bacillus cereus G9241 to cause anthrax-like disease. Mol Microbiol.
2011;80(2):455–470.

21. Wilson MK, Vergis JM, Alem F, et al. Bacillus cereus G9241 makes anthrax
toxin and capsule like highly virulent B. anthracis Ames but behaves like
attenuated toxigenic nonencapsulated B. anthracis Sterne in rabbits and mice
[published online ahead of print May 16, 2011]. Infect Immun. 2011;79(8):3012–
3019. doi:10.1128/IAI.00205-11.

22. Forsberg LS, Choudhury B, Leoff C, et al. Secondary cell wall
polysaccharides from Bacillus cereus strains G9241, 03BB87, and 03BB102
causing fatal pneumonia share similar glycosyl structures with the polysaccha-
rides from Bacillus anthracis. Glycobiology. 2011;21(7):934–948.

23. Gohar M, Faegri K, Perchat S, et al. The PlcR virulence regulon of Bacillus
cereus. PLoS One. 2008;3(7):e2793.

24. Easterday WR, Van Ert MN, Simonson TS, et al. Use of single nucleotide
polymorphisms in the plcR gene for specific identification of Bacillus anthracis.
J Clin Microbiol. 2005;43(4):1995–1997.

25. Slamti L, Perchat S, Gominet M, et al. Distinct mutations in PlcR explain
why some strains of the Bacillus cereus group are nonhemolytic. J Bacteriol.
2004;186(11):3531–3538.

26. Noguera PA, Ibarra JE. Detection of new cry genes of Bacillus thuringiensis
by use of a novel PCR primer system. Appl Environ Microbiol. 2010;76(18):
6150–6155.

27. Kern JW, Schneewind O. BslA, a pXO1-encoded adhesin of Bacillus
anthracis. Mol Microbiol. 2008;68(2):504–515.

28. Budzik JM, Marraffini LA, Schneewind O. Assembly of pili on the surface
of Bacillus cereus vegetative cells. Mol Microbiol. 2007;66(2):495–510.

29. Shea PR, Beres SB, Flores AR, et al. Distinct signatures of diversifying
selection revealed by genome analysis of respiratory tract and invasive bacterial
populations. Proc Natl Acad Sci U S A. 2011;108(12):5039–5044.

30. Beres SB, Carroll RK, Shea PR, et al. Molecular complexity of successive
bacterial epidemics deconvoluted by comparative pathogenomics. Proc Natl
Acad Sci U S A. 2010;107(9):4371–4376.

31. Hernandez D, Francois P, Farinelli L, Osterås M, Schrenzel J. De novo
bacterial genome sequencing: millions of very short reads assembled on a
desktop computer. Genome Res. 2008;18(5):802–809.

32. Bimber BN, Dudley DM, Lauck M, et al. Whole-genome characterization
of human and simian immunodeficiency virus intrahost diversity by ultradeep
pyrosequencing. J Virol. 2010;84(22):12087–12092.

33. Matsumoto M, Hoe NP, Liu M, et al. Intrahost sequence diversity in the
streptococcal inhibitor of complement gene in patients with pharyngitis. J Infect
Dis. 2003;187(4):604–612.

34. Sozhamannan S, Chute MD, McAfee, FD, et al. The Bacillus anthracis
chromosome contains four conserved excision-proficient, putative prophages.
BMC Microbiol. 2006;6:34.

35. Rasko DA, Worsham PL, Abshire TG, et al. Bacillus anthracis comparative
genome analysis in support of the Amerithrax investigation. Proc Natl Acad Sci
U S A. 2011;108(12):5027–5032.

36. Jonsson S, Clarridge J, Young EJ. Necrotizing pneumonia and empyema
caused by Bacillus cereus and Clostridium bifermentans. Am Rev Respir Dis.
1983;127(3):357–359.

37. Bekemeyer WB, Zimmerman GA. Life-threatening complications asso-
ciated with Bacillus cereus pneumonia. Am Rev Respir Dis. 1985;131(3):
466–469.

38. Coggon D, Insjip H, Winter P, Pannett B. Lobar pneumonia: an
occupational disease in welders. Lancet. 1994;344(8914):41–43.

39. Chin CS, Sorenson J, Harris JB, et al. The origin of the Haitian cholera
outbreak strain. N Engl J Med. 2011;364(1):33–42.

1458 Arch Pathol Lab Med—Vol 135, November 2011 Fatal, Anthrax-like Infection—Wright et al

40. Lienau EK, Strain E, Wang C, et al. Identification of a Salmonellosis outbreak
by means of molecular sequencing. N Engl J Med. 2011;364(10):981–982.

41. Abramova FA, Grinberg LM, Yampolskaya OV, Walker DH. Pathology of
inhalational anthrax in 42 cases from the Sverdlovsk outbreak of 1979. Proc Natl
Acad Sci U S A. 1993;90(6):2291–2294.

42. Bielaszewska M, Mellman A, Zhang W, et al. Characterisation of the
Escherichia coli strain associated with an outbreak of haemolytic uraemic
syndrome in Germany in 2011: a microbiological study [published online ahead
of print June 23, 2011]. Lancet Infect Dis. doi: 10.1016/S1473-3099(11)70165-7.

43. Frank C, Werber D, Cramer JP, et al. Epidemic profile of Shiga-
toxin–producing Escherichia coli O104:H4 in Germany—preliminary report
[published online ahead of print June 22, 2011]. N Engl J Med. doi 10.1056/
NEJMoa1106483.

44. Rhode H, Qin J, Cui Y, et al. Open-source genomic analysis of Shiga-
toxin–producing E. coli [published online ahead of print July 27, 2011]. N Engl J
Med. doi: 10.1056/NEJMoa1107643.

45. Musser JM. Third-track pathology: in unambiguous support of the Banbury
Conference Report. Arch. Pathol Lab Med. 2011;135(6):687–688.

Arch Pathol Lab Med—Vol 135, November 2011 Fatal, Anthrax-like Infection—Wright et al 1459

<< /ASCII85EncodePages false /AllowTransparency false /AutoPositionEPSFiles true /AutoRotatePages /None /Binding /Left /CalGrayProfile (Dot Gain 30%) /CalRGBProfile (None) /CalCMYKProfile (U.S. Sheetfed Coated v2) /sRGBProfile (sRGB IEC61966-2.1) /CannotEmbedFontPolicy /Error /CompatibilityLevel 1.4 /CompressObjects /Off /CompressPages true /ConvertImagesToIndexed false /PassThroughJPEGImages true /CreateJobTicket false /DefaultRenderingIntent /Default /DetectBlends true /DetectCurves 0.1000 /ColorConversionStrategy /LeaveColorUnchanged /DoThumbnails false /EmbedAllFonts true /EmbedOpenType false /ParseICCProfilesInComments true /EmbedJobOptions true /DSCReportingLevel 0 /EmitDSCWarnings false /EndPage -1 /ImageMemory 1048576 /LockDistillerParams false /MaxSubsetPct 100 /Optimize false /OPM 1 /ParseDSCComments false /ParseDSCCommentsForDocInfo true /PreserveCopyPage true /PreserveDICMYKValues true /PreserveEPSInfo true /PreserveFlatness true /PreserveHalftoneInfo false /PreserveOPIComments false /PreserveOverprintSettings true /StartPage 1 /SubsetFonts true /TransferFunctionInfo /Apply /UCRandBGInfo /Remove /UsePrologue false /ColorSettingsFile () /AlwaysEmbed [ true ] /NeverEmbed [ true ] /AntiAliasColorImages false /CropColorImages true /ColorImageMinResolution 150 /ColorImageMinResolutionPolicy /OK /DownsampleColorImages true /ColorImageDownsampleType /Bicubic /ColorImageResolution 600 /ColorImageDepth 8 /ColorImageMinDownsampleDepth 1 /ColorImageDownsampleThreshold 1.50000 /EncodeColorImages true /ColorImageFilter /FlateEncode /AutoFilterColorImages false /ColorImageAutoFilterStrategy /JPEG /ColorACSImageDict << /QFactor 0.15 /HSamples [1 1 1 1] /VSamples [1 1 1 1] >>
/ColorImageDict << /QFactor 0.40 /HSamples [1 1 1 1] /VSamples [1 1 1 1] >>
/JPEG2000ColorACSImageDict << /TileWidth 256 /TileHeight 256 /Quality 30 >>
/JPEG2000ColorImageDict << /TileWidth 256 /TileHeight 256 /Quality 30 >>
/AntiAliasGrayImages false
/CropGrayImages true
/GrayImageMinResolution 150
/GrayImageMinResolutionPolicy /OK
/DownsampleGrayImages true
/GrayImageDownsampleType /Bicubic
/GrayImageResolution 600
/GrayImageDepth 8
/GrayImageMinDownsampleDepth 2
/GrayImageDownsampleThreshold 1.50000
/EncodeGrayImages true
/GrayImageFilter /FlateEncode
/AutoFilterGrayImages false
/GrayImageAutoFilterStrategy /JPEG
/GrayACSImageDict << /QFactor 0.15 /HSamples [1 1 1 1] /VSamples [1 1 1 1] >>
/GrayImageDict << /QFactor 0.40 /HSamples [1 1 1 1] /VSamples [1 1 1 1] >>
/JPEG2000GrayACSImageDict << /TileWidth 256 /TileHeight 256 /Quality 30 >>
/JPEG2000GrayImageDict << /TileWidth 256 /TileHeight 256 /Quality 30 >>
/AntiAliasMonoImages false
/CropMonoImages true
/MonoImageMinResolution 1200
/MonoImageMinResolutionPolicy /OK
/DownsampleMonoImages true
/MonoImageDownsampleType /Bicubic
/MonoImageResolution 1200
/MonoImageDepth -1
/MonoImageDownsampleThreshold 1.50000
/EncodeMonoImages true
/MonoImageFilter /CCITTFaxEncode
/MonoImageDict << /K -1 >>
/AllowPSXObjects false
/CheckCompliance [
/None
]
/PDFX1aCheck false
/PDFX3Check false
/PDFXCompliantPDFOnly true
/PDFXNoTrimBoxError false
/PDFXTrimBoxToMediaBoxOffset [
0.00000
0.00000
0.00000
0.00000
]
/PDFXSetBleedBoxToMediaBox false
/PDFXBleedBoxToTrimBoxOffset [
0.00000
0.00000
0.00000
0.00000
]
/PDFXOutputIntentProfile (Euroscale Coated v2)
/PDFXOutputConditionIdentifier (FOGRA1)
/PDFXOutputCondition ()
/PDFXRegistryName (http://www.color.org)
/PDFXTrapped /False
/CreateJDFFile false
/SyntheticBoldness 1.000000
/Description << /DEU
/FRA
/JPN
/PTB
/DAN
/NLD
/ESP
/SUO
/ITA
/NOR
/SVE
/ENU (Settings for the Rampage workflow.)
>>
>> setdistillerparams
<< /HWResolution [2400 2400] /PageSize [612.000 792.000] >> setpagedevice